Taqman primers

Total RNA was extracted from cells and tissues using the TRIzol reagent (Invitrogen) and reversely transcribed into cDNA using the PrimeScript RT reagent kits (Takara, Dalian, China). The TaqMan primers and probes used for detection were all from Takara. RT-qPCR was performed using ABI PRISM 7900 sequence detection system of SYBR Green II (Takara). PCR reaction conditions: predenaturation at 95°C for 5 minutes and 40 cycles of denaturation at 95°C for 15 seconds, annealing at 60°C for 20 seconds, and extension at 72°C for 35 seconds. With GAPDH as an internal reference, the data were analyzed with the 2^−ΔΔCt method. Primer sequences (synthesized by Sangon Biotech, Shanghai, China) are shown in Table 1 [46 (link)].

Total RNA was extracted from astrocytes using TRIzol (Invitrogen, USA) according to the manufacturer’s instructions. The cDNA templates were synthesized from total RNA using a Transcriptor First Strand cDNA Synthesis kit (TaKaRa Biotechnology). TaqMan primers and probes used for testing were obtained from TaKaRa Biotechnology, Japan. GAPDH was used as an endogenous reference. Quantitative PCR using SYBR Green II (TaKaRa Biotechnology) was performed with an ABI PRISM 7900 Sequence Detector system (Applied Biosystems). Target gene expression was normalized to GAPDH expression, and the values were calculated relative to control values using the ΔΔCT method. The following PCR primers were used (5′ to 3′): IL-1β-F, GACCTGTTCTTTGAGGCTGACA and IL-1β-R, CTCATCTGGACAGCCCAAGTC; IL-6-F, TAGTCCTTCCTACCCCAACTTCC and IL-6-R, TTGGTCCTTAGCCACTCCTTC; TGF-β-F, CATTGCTGTCCCGTGCAGA and TGF-β-R, AGGTAACGCCAGGAATTGTTGCTA; TNF-α-F, TTCCAATGGGCTTTCGGAAC and TNF-α-R, AGGTAACGCCAGGAATTGTTGCTA; VEGF-A-F, TCCTGCAGCATAGCAGATGTGA and VEGF-A-R, CCAGGATTTAAACCGGGATTTC; MMP-2-F, TCCCGAGATCTGCAAGCAAG and MMP-2-R, AGAATGTGGCCACCAGCAAG; MMP-9-F, GGGAACGTATCTGGAAATTCGAC and MMP-9-R, CCGGTTGTGGAAACTCACAC; MCP-1-F, TGTCTCAGCCAGATGCAGTTAAT and MCP-1-R, CCGACTCATTGGGATCATCTT; CXCL-1-F, CAATGAGCTGCGCTGTCAGT and CXCL-1-R, TTGAAGTGAATCCCTGCCACT; and GAPDH-F, GGCACAGTCAAGGCTGAGAATG and GAPDH-R, ATGGTGGTGAAGACGCCAGTA.