Adipo-Sun1-sfGFP-myc mice were used for the specific isolation of adipocyte chromatin. Finely minced adipose tissue was fixed for 30 minutes in 2mM disuccinimidyl glutarate and then for 10 minutes in 1% formaldehyde. Fixed tissue was then dounced in homogenization buffer (5mM NaCl, 0.05mM EDTA pH 7.5, 5mM, 0.005% NP40, 0.01% Triton X-100) and filtered through a 30-micron mesh. Filtrates were centrifuged to pellet nuclei, which were thoroughly resuspended in homogenization buffer and affinity purified using anti-c-myc magnetic beads (Pierce). Isolated adipocyte nuclei were sonicated using a Diagenode Bioruptor. Sheared chromatin was incubated with antibodies against BCL6 (affinity-purified guinea pig IgG) and precipitated with M280 paramagnetic beads (ThermoFisher) coated with anti-guinea pig IgG. DNA was isolated using MinElute PCR purification columns (QIAGEN). ChIP qPCR assays were performed using duplicates. Primer sequences for ChIP-qPCR are listed in Table S3 .
M280 paramagnetic beads
Manufactured by Thermo Fisher Scientific
The M280 paramagnetic beads are a type of laboratory equipment used for various applications in life science research. They are composed of a polymer matrix with embedded magnetic particles, allowing for magnetic separation and manipulation. The core function of the M280 paramagnetic beads is to serve as a solid support for binding and isolating target molecules, such as proteins, nucleic acids, or cells, from complex biological samples.
Automatically generated - may contain errors
Lab products found in correlation
3 protocols using m280 paramagnetic beads
1
Isolation and ChIP of Adipocyte Chromatin
2
Isolation and ChIP of Adipocyte Chromatin
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Adipo-Sun1-sfGFP-myc mice were used for the specific isolation of adipocyte chromatin. Finely minced adipose tissue was fixed for 30 minutes in 2mM disuccinimidyl glutarate and then for 10 minutes in 1% formaldehyde. Fixed tissue was then dounced in homogenization buffer (5mM NaCl, 0.05mM EDTA pH 7.5, 5mM, 0.005% NP40, 0.01% Triton X-100) and filtered through a 30-micron mesh. Filtrates were centrifuged to pellet nuclei, which were thoroughly resuspended in homogenization buffer and affinity purified using anti-c-myc magnetic beads (Pierce). Isolated adipocyte nuclei were sonicated using a Diagenode Bioruptor. Sheared chromatin was incubated with antibodies against BCL6 (affinity-purified guinea pig IgG) and precipitated with M280 paramagnetic beads (ThermoFisher) coated with anti-guinea pig IgG. DNA was isolated using MinElute PCR purification columns (QIAGEN). ChIP qPCR assays were performed using duplicates. Primer sequences for ChIP-qPCR are listed in Table S3 .
3
Chromatin Immunoprecipitation of Nde1 and Smc3
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cerebral cortical tissue was dissected from wild type embryos at E12.5, fixed for 30 minutes in 2 mM disuccinimidyl glutarate and then for 10 minutes in 1% formaldehyde. Fixed tissue was suspended in 5 mM NaCl, 0.05 mM EDTA pH 7.5, 5 mM, 0.005% NP40, 0.01% Triton X-100 to isolate nuclei. Isolated nuclei were sonicated using a Diagenode Bioruptor. Sheared chromatin was incubated with antibodies against Nde1 and Smc3, respectively, then precipitated with M280 paramagnetic beads (ThermoFisher) coated with anti-rabbit IgG. DNA was isolated using MinElute PCR purification columns (QIAGEN). Primer sequences for ChIP-PCR are: Major Satellite: GACGACTTGAAAAATGACGAAATC and CATATTCCAGGTCCTTCAGTGTGC;
Minor satellite: GAACATATTAGATGAGTGAGTTAC and GTTCTACAAATCCCGTTTCCAAC.
Minor satellite: GAACATATTAGATGAGTGAGTTAC and GTTCTACAAATCCCGTTTCCAAC.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!