Sequences of interest in genomic DNA were amplified with SuperFi DNA polymerase (Thermo Scientific) in 50 µl PCR reactions containing 1X SuperFi buffer, 0.2 mM dNTP, 500 nM Fwd/Rev PCR primers, 330 ng gDNA and 0.04 U/µl SuperFi DNA polymerase. The PCR program was as follows: 98 °C for 30 s, 15 cycles of 98 °C for 15 s, 60 °C for 30 s, 72 °C for 10 s, and a final elongation at 72 °C for 5 min.
Superfi dna polymerase
Manufactured by Thermo Fisher Scientific
Sourced in United States
SuperFi DNA polymerase is a high-fidelity DNA polymerase designed for accurate DNA amplification in PCR applications. It exhibits enhanced proofreading activity, providing improved accuracy and fidelity compared to standard Taq DNA polymerases.
Automatically generated - may contain errors
Lab products found in correlation
Pgex 4t 1, by GE Healthcare (3 mentions)
Plenti puro, by Addgene (2 mentions)
Nanobit system vectors, by Promega (2 mentions)
Platinum pfx, by Thermo Fisher Scientific (2 mentions)
Lenticrispr v2 vector, by Addgene (1 mentions)
Pcr4 topo ta vector, by Thermo Fisher Scientific (1 mentions)
Nucleospin plant 2 kit, by Macherey-Nagel (1 mentions)
Lightcycler 480 2 system, by Roche (1 mentions)
High resolution melting master, by Roche (1 mentions)
Pbit1.1 n, by Promega (1 mentions)
Mmessage mmachine t7 kit, by Thermo Fisher Scientific (1 mentions)
Pcdna3, by Thermo Fisher Scientific (1 mentions)
Oligonucleotide primers, by Genomed (1 mentions)
Geneelute plasmid miniprep kit, by Merck Group (1 mentions)
8 protocols using superfi dna polymerase
1
Rapid PCR Amplification of Genomic DNA
2
Molecular Cloning and Genome Engineering
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
All polymerase chain reaction amplification and site-directed mutagenesis, including point and deletion mutations, were performed using SuperFi DNA polymerase (Thermo Fisher Scientific). Subcloning of open reading frames and their derivatives into expression plasmids, including pICE (a gift from Steve Jackson, Addgene plasmid #46960), pGEX-4T-1 (GE Healthcare Life Sciences), pLenti.puro (a gift from Melina Fan, Addgene plasmid #74218), and NanoBiT system vectors (Promega), was performed using appropriate restriction enzyme sites. In addition, the LentiCRISPR v2 vector (a gift from Feng Zhang, Addgene plasmid #52961) was used for the lentiviral transduction of GABARAPL1 sgRNA into HeLa.Kyoto, iSLK.BAC16, iBCBL-1 cells, and NIX sgRNA into iBCBL-1 cells.
3
High-throughput genomic DNA extraction and HRM analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genomic DNA from control and regenerated plants was extracted using the NucleoSpin Plant II kit (Macherey–Nagel, Germany) according to the manufacturer’s instructions. HRM analysis was performed using the High Resolution Melting Master (Roche Applied Science, Germany) on the LightCycler® 480 II system (Roche Applied Science, Germany) (S1 Table ), as previously described [19 (link)]. Plants harboring a HRM mutated profile were then Sanger sequenced (Genoscreen, France) (S1 Table ). Plants harboring mutations at the StDMR6-1 locus with the pDeSaCas9 constructs were further analyzed by cloning the PCR products (Superfi DNA polymerase, ThermoFisher Scientific, USA) into the pCR4-TOPO TA vector (ThermoFisher Scientific, USA), followed by Sanger sequencing (Genoscreen, France).
4
Site-directed mutagenesis and protein expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
All polymerase chain reaction (PCR) amplification and site-directed mutagenesis, including point and deletion mutations were performed using Platinum™ Pfx or SuperFi™ DNA polymerase (Thermo Fisher Scientific). Subcloning of open reading frames (ORFs) and their derivatives into expression plasmids including pICE (a gift from Steve Jackson; Addgene plasmid #46960), pGEX-4T-1 (GE Healthcare Life Sciences), and NanoBiT® system vectors (Promega) was performed using appropriate restriction enzyme sites (Supplementary Table 1 ). Overlap extension PCR56 (link) was carried out for replacement of the NIX tail-anchor (TA) region with the TA region of other tail-anchored proteins and the fused genes were cloned into vectors pBiT1.1-N (Promega) and pICE_V533 (link). Primers are listed in Supplementary Table 3 .
5
Amplification and Synthesis of Xenopus Constructs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A polymerase chain reaction (PCR) of all constructs using forward primer pTD2F (5′‐TTGGCACCAAAATCAACGGG–3′) and reverse primer SP6 was carried out with SuperFi DNA Polymerase (ThermoFischer Scientific, USA) and agarose gel purified (Zymo Research, USA). These primers amplify the gene insert, the 3′ and 5′ X. laevis beta‐globin UTRs and a 3′ poly‐A tail. In vitro transcription of the PCR products using the mMESSAGE mMACHINE T7 kit (Ambion, USA) was performed following manufacturers' protocol. cRNA was precipitated with lithium chloride and dissolved in RNase‐free water and the concentration was determined using a Nanodrop spectrophotometer. The desired subunit and ric‐3 combinations were mixed and diluted with nuclease‐free water to final injection concentrations of 250 ng/μL each.
6
Plasmid Cloning and Mutagenesis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
All polymerase chain reaction amplification and site-directed mutagenesis including point and deletion mutations were performed using SuperFi™ DNA polymerase (Thermo Fisher Scientific). Subcloning of open reading frames and their derivatives into expression plasmids including pICE (a gift from Steve Jackson; Addgene plasmid #46960), pcDNA3.1(+) (Invitrogen), plenti.puro (a gift from Melina Fan; Addgene plasmid #74218), pGEX-4T-1 (GE Healthcare Life Sciences), and pTYB4 (New England Biolab). Plasmids were purified using ZymoPURE II Plasmid Midiprep kit for transfection (Zymo Research). The plasmids and oligonucleotides used in this study are listed in Tables S1 and S2 , respectively.
7
CRISPR Plasmid Construction and PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
All polymerase chain reaction (PCR) amplification and site-directed mutagenesis were performed using Platinum™ Pfx or SuperFi™ DNA polymerase (Thermo Fisher Scientific). Subcloning of open reading frames (ORFs) and their derivatives into expression plasmids was conducted using appropriate restriction enzyme sites (Supplemental Table 2). Small guide RNAs (gRNAs) for each gene were selected using Deskgen software, synthesized by Integrated DNA Technologies, and cloned into plentiCRISPR v2-puro [65] (link) or plentiCRISPR v2-blasticidin (a gift from Mohan Babu, Addgene plasmid #83480) using BsmBI. Oligonucleotides are listed in Supplemental Table 3.
8
Standard Molecular Biology Techniques
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Standard protocols for DNA isolation, PCR, molecular cloning, transformation, and DNA analysis were used (Sambrook and Russell 2001) . Plasmids and primers used in this work are listed in Supplementary Table S2. Oligonucleotide primers were supplied by Genomed. Plasmid DNA purification was performed using MiniPrep Express Matrix (MP Biomedicals) and GeneElute plasmid miniprep kit (Sigma-Aldrich). PCR was performed with high-fidelity SuperFi DNA polymerase (Thermo Fisher Scientific). DNA sequencing of plasmid constructs prepared in this work was performed by Genomed. Sequence data were analyzed with DNASTAR Lasergene analysis software.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!