Cells were grown to ∼70% confluence in six-well plates. Cells were then treated with IMiD compounds as indicated before RNA extractions were performed using the RNeasy Mini Kit (QIAGEN). RNA was quantified using a NanoDrop 3300 Fluorospectrometer (Thermo Fisher Scientific). Synthesis of cDNA was completed using iScript cDNA Synthesis Kit (Bio-Rad) and 1 μg of RNA per reaction. qRT-PCR was performed in triplicate in a 10 μl final volume with 2 μM forward primer, 2 μM reverse primer, 50% (vol/vol) iQ SYBR Green Supermix (Bio-Rad), and 2 μl cDNA (diluted 1:5) using a CFX384 real-time system qRT-PCR machine (Bio-Rad). Primers were designed using Benchling and purchased from Invitrogen. Axin2 forward: TACACTCCTTATTGGGCGATCA, Axin2 reverse: TTGGCTACTCGTAAAGTTTTGGT, GAPDH forward: TGCACCACCAACTGCTTAGC, GAPDH reverse: GGCATGGACTGTGGTCATGAG. The datasets were analysed using the comparative Ct method (ΔΔCt Method) (Livak & Schmittgen, 2001 (link)) with Axin2 the Wnt-target gene and GAPDH the endogenous control gene. Statistical analysis was performed using Microsoft Excel software (www.microsoft.com ) and graphical representations of data were prepared using Prism 8 (www.graphpad.com ).
Cfx384 real time system qrt pcr machine
Manufactured by Bio-Rad
The CFX384 real-time system is a qRT-PCR machine manufactured by Bio-Rad. It is designed for gene expression analysis and quantitative real-time PCR applications.
Automatically generated - may contain errors
Lab products found in correlation
Nanodrop 3300 fluorospectrometer, by Thermo Fisher Scientific (2 mentions)
Iq sybr green supermix, by Bio-Rad (2 mentions)
Rneasy mini kit, by Qiagen (2 mentions)
Prism 8, by GraphPad (2 mentions)
Iscript cdna synthesis kit, by Bio-Rad (2 mentions)
Sybr green master mix, by Bio-Rad (1 mentions)
Iscript cdna kit, by Bio-Rad (1 mentions)
Sybr green, by Bio-Rad (1 mentions)
4 protocols using cfx384 real time system qrt pcr machine
1
Quantitative RT-PCR Analysis of Wnt Signaling
2
Quantitative Real-Time Reverse Transcription PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Real-time quantitative reverse transcription PCR (qRT-PCR) was carried out using 1 µg of isolated RNA and the SuperScript cDNA kit (Invitrogen) according to the manufacturer's protocol. qRT-PCRs were performed in triplicate (10 µl) according to the manufacturer's protocol, including forward and reverse primers (0.5 µM each), 50% SYBR green master mix (BioRad) and a cDNA equivalent of 1 ng µl−1 RNA in a CFX 384 real-time system qRT-PCR machine (BioRad). The data were normalized to the geometrical mean of two housekeeping genes (GAPDH and HPRT1) and analysed by the Pfaffl method [45 (link)].
3
Quantitative RT-PCR Analysis of Wnt Signaling
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cells were plated in six-well plates and grown to ∼70% confluence in complete culture medium, then conditioned-medium or treatment added as indicated. RNA extractions were completed using RNeasy mini kit (74104; QIAGEN) following the manufacturer’s instructions and RNA was quantified using a NanoDrop 3300 Fluorospectrometer (Thermo Fisher Scientific). Synthesis of cDNA was completed using 1 μg of RNA and the iScript cDNA synthesis kit (Bio-Rad). Each qRT-PCR was performed as triplicate reactions with the following reaction mixture: 2 μM forward primer, 2 μM reverse primer, 50% (vol/vol) iQ SYBR green supermix (Bio-Rad), and 2 μl cDNA (diluted 1:5) in a 10 μl final volume. Reactions were completed on a CFX384 real-time system qRT-PCR machine (Bio-Rad). Primers were designed using Benchling (www.benchling.com ) and purchased from Invitrogen. Axin2 forward: TACACTCCTTATTGGGCGATCA, Axin2 reverse: TTGGCTACTCGTAAAGTTTTGGT, GAPDH forward: TGCACCACCAACTGCTTAGC, GAPDH reverse: GGCATGGACTGTGGTCATGAG. The comparative Ct method (ΔΔCt Method) was used to analyse the datasets with Axin2 the Wnt target gene and GAPDH the endogenous control gene. Statistical analysis and preparation of graphs was completed using Microsoft Excel software (www.microsoft.com ) and Prism 8 (www.graphpad.com ), respectively.
4
qRT-PCR Analysis of TGFβ1-Induced Transcripts
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
qRT-PCR experiments were performed as previously described35 (link)36 (link). Cells were seeded onto 6-well plates, serum starved for 16 h prior to TGFβ1 (50 pM) treatment. cDNA was made from 1 µg of the isolated RNA using the I-Script cDNA kit (BioRad) according to the manufacturer’s protocol. qRT-PCR reactions were performed in quadruplicate according to the manufacturer’s protocol in a CFX 384 Real time System qRT-PCR machine (BioRad). Each reaction included cDNA (2.5% of reverse transcriptase reaction) with forward and reverse primers (0.5 μM each) and 50% SYBR Green (BioRad). All primers were designed using PerlPrimer® and purchased from Invitrogen. Primers used are as follows (5′-3′): PAI-1 forward: AGCTCCTTGTACAGATGCCG, reverse: ACAACAGGAGGAGAAACCCA, GAPDH forward: TGCACCACCAACTGCTTAGC, reverse: GGCATGGACTGTGGTCATGAG, RPL13A forward: CCTGGAGGAGAAGAGGAAAGAGA, reverse: TTGAGGACCTCTGTGTATTTGTCAA. The primer efficiency was determined and taken into account when evaluating the qRT-PCR data. The data was normalised to the geometrical mean of two housekeeping genes (GAPDH and RPLI3A) and the Pfaffl method37 (link) was used to analyse the qRT-PCR data.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!