Reverse transcription of total RNA was performed according to Madsen et al. (2009 (link)). The reaction contained the total RNA (200 ng), 4 μl mixed primers (oligodT primer/random hexamer primer = 1:3 (0.5 μg/μl)), 16 μl 5× ImPromII buffer, 4 μl dNTP mix (10 mM each), 8 μl 25 mM MgCl2, and 4 μl ImPromII (Promega). The single-stranded DNA product was stored at −20 °C.
Improm 2
Manufactured by Promega
Sourced in United States, United Kingdom
The ImProm-II™ Reverse Transcription System is a kit designed for the reverse transcription of RNA into cDNA. It includes an RNase H-deficient reverse transcriptase, buffer, and other necessary components to facilitate the conversion of RNA to cDNA.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (22 mentions)
Trizol, by Thermo Fisher Scientific (16 mentions)
Random hexamer, by Promega (10 mentions)
Geneamp pcr system 9700 thermal cycle, by Thermo Fisher Scientific (9 mentions)
Dntps mix, by Promega (8 mentions)
Rnase inhibitor, by Promega (8 mentions)
Fast sybr green master mix, by Thermo Fisher Scientific (7 mentions)
Rneasy mini kit, by Qiagen (6 mentions)
Cfx96 real time pcr detection system, by Bio-Rad (5 mentions)
Iq sybr green supermix, by Bio-Rad (5 mentions)
Cfx96 touch real time pcr detection system, by Bio-Rad (5 mentions)
Steponeplus qpcr system, by Thermo Fisher Scientific (4 mentions)
Turbo dna free rnase free dnase, by Thermo Fisher Scientific (4 mentions)
Gotaq qpcr master mix, by Promega (4 mentions)
Rneasy column, by Qiagen (4 mentions)
Dnase, by Qiagen (4 mentions)
Sybr green pcr master mix, by Thermo Fisher Scientific (4 mentions)
Sybr premix ex taq, by Takara Bio (4 mentions)
Tri reagent, by Molecular Research Center (4 mentions)
Tri reagent, by Thermo Fisher Scientific (4 mentions)
157 protocols using improm 2
1
Total RNA Reverse Transcription
2
Amplification of CVA9 Viral Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA from CVA9 samples was extracted using a QIAamp MinElute Virus Spin Kit (Qiagen GmbH, Düsseldorf, Germany) following the manufacturer’s instructions. Primers (OS/OAS and IS/IAS) for VP1 and 3Dpol and modified semi-nested PCR protocol were described previously [35 (link)]. In short, reverse transcription (RT) step was performed in 10 µL volume and contained 0.5 µL ImProm II (Promega, Madison, WI, USA), 1 µL OAS primer at 1 µM final concentration, ImProm II buffer, RNasin, and ddH2O. Samples were incubated at 42 °C for 60 min. Five microliters of RT sample was added to 25 µL PCR1 reaction, which included 0.5 µL Platinum Taq High Fidelity enzyme, 2.5 µL primers at 1 µM final concentration, buffer, and ddH2O. Cycling conditions for both VP1 and 3Dpol amplification were 95 °C for 3 min, then 35 cycles of denaturation at 95 °C for 20 s, annealing at 50 °C for 30 s and extension at 72 °C for 60 s. Final extension stage was for 5 min. In snPCR2, 1 µL of PCR1 reaction product was used.
3
Quantifying microRNA Expression by RT-qPCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Synthesis and amplification of cDNA were conducted using miRNA-specific TaqMan microRNA Expression Assays (4427975, ThermoFisher™) for hsa-miR-103-3p (ID: 000439), hsa-miR-16-5p (ID: 000391), hsa-miR-191-5p (ID: 002299), hsa-miR-21-5p (ID: 000397), hsa-miR-141-3p (ID: 000463), and hsa-miR-221-3p (ID: 000524).
First, a total 80 ng of RNA was mixed with 3 μℓ of TaqMan MicroRNA Assay RT primers (4427975, ThermoFisher™), 3μℓ of 5× Reaction Buffer (ImProm II; Promega), 1.2 μℓ of 25 mM MgCl2 (Promega), 1 μℓ of 10 mM dNTP mix (Promega), 0.5 μℓ of ribonuclease inhibitor (RNasin; Promega), 0.5 μℓ of reverse transcriptase (ImProm II; Promega), and nuclease-free water for 15 μℓ reaction of reverse transcription. The reverse transcription reaction was performed as follows: 16°C for 30 min, 42°C for 30 min, 85°C for 30 min, cooling at 4°C.
Then, 1 μℓ of reverse transcription products was mixed with 1 μℓ of TaqMan® MicroRNA Assay TM primers (4427975, ThermoFisher™), 10 μℓ of Taqman® Universal PCR Master Mix, no AmpErase® UNG (4324018, ThermoFisher™), and nuclease-free water for 20 μℓ reaction of amplification. The qPCR reaction was performed as follows: 95°C for 10 min, 45 repeated cycles of 95°C for 15 s, and then 60°C for 1 min.
First, a total 80 ng of RNA was mixed with 3 μℓ of TaqMan MicroRNA Assay RT primers (4427975, ThermoFisher™), 3μℓ of 5× Reaction Buffer (ImProm II; Promega), 1.2 μℓ of 25 mM MgCl2 (Promega), 1 μℓ of 10 mM dNTP mix (Promega), 0.5 μℓ of ribonuclease inhibitor (RNasin; Promega), 0.5 μℓ of reverse transcriptase (ImProm II; Promega), and nuclease-free water for 15 μℓ reaction of reverse transcription. The reverse transcription reaction was performed as follows: 16°C for 30 min, 42°C for 30 min, 85°C for 30 min, cooling at 4°C.
Then, 1 μℓ of reverse transcription products was mixed with 1 μℓ of TaqMan® MicroRNA Assay TM primers (4427975, ThermoFisher™), 10 μℓ of Taqman® Universal PCR Master Mix, no AmpErase® UNG (4324018, ThermoFisher™), and nuclease-free water for 20 μℓ reaction of amplification. The qPCR reaction was performed as follows: 95°C for 10 min, 45 repeated cycles of 95°C for 15 s, and then 60°C for 1 min.
4
Transfection and qPCR Analysis in HEK293 Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Human embryonic kidney (HEK293 and HEK293T) cells were cultured in DMEM (Invitrogen) supplemented with 10% FCS, l -glutamine (2 mM), penicillin, and streptomycin and grown in 5% CO2 at 37°C. For reporter assays, cells were cotransfected using Fugene 6 reagent (Roche) with expression vectors encoding the splice reporter and RNA-binding proteins. RNA was harvested 24–36 h after transfection using Trizol reagent (Invitrogen), followed by removal of contaminating DNA using Turbo DNA-free (RNase-free DNase; Ambion). 1 µg of total RNA was reverse transcribed using random hexamers and ImProm-II (Promega).
For semi-quantitative PCR, DNA fragment intensities were quantified by image analyzer (FAS-III; Toyobo) and ImageGauge software (Fujifilm). Oligonucleotide primers used for semi-quantitative PCR were described previously (Iijima et al., 2011 (link)).
Quantitative PCR was performed on a StepOnePlus qPCR system (Applied Biosystems). Custom and commercial gene expression assays (seeTable 1 ) were used with TaqMan Master Mix (Applied Biosystems) and comparative CT method. The mRNA levels were normalized to that of Gapdh mRNA.
For semi-quantitative PCR, DNA fragment intensities were quantified by image analyzer (FAS-III; Toyobo) and ImageGauge software (Fujifilm). Oligonucleotide primers used for semi-quantitative PCR were described previously (Iijima et al., 2011 (link)).
Quantitative PCR was performed on a StepOnePlus qPCR system (Applied Biosystems). Custom and commercial gene expression assays (see
5
Quantifying mRNA and miRNA Levels
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was isolated using TRIzol reagent (Invitrogen, Carlsbad, USA), and cDNA was synthesized using an Improm II reverse transcription kit (Promega, WI, USA). QRT-PCR was performed with SYBR Green to detect mRNA levels. The mRNA levels were calculated relative to the control Gapdh (for mRNA) or U6 (for miRNA) using the 2−ΔΔCq method.
6
Extraction and qPCR Analysis of Bacterial mRNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
mRNA was extracted from bacteria grown in BHI at O.D. 0.5. Bacterial pellet was resuspended in 1ml of TRIzol and lysed using lysing matrix B 2 ml tubes and FastPrep 2 cycle 6.5 m/s with 60 sec on ice between cycles. RNA was then purified using kit Directzol RNA MiniPrep (Zymo Research), treated with Dnase I (Roche) for 2.5 hrs at 37°C and further purified using RNA cleaning using KIT (Quiagen). cDNA was then prepared using the ImPromII reverse transcriptase (Promega). qPCR was performed using SsoAdvanced Universal SYBR Green Supermix (Biorad). Genes of interest were amplified using primers: AACCAATTGACAACTATTCCTGA, TGGTGTAGTTAACCATCGTACCAG for inlP (lmo2470) and inlP-ΔLRR5; CTTCCGCAATGGACGAAAGT, ACGATCCGAAAACCTTCTTCATAC for detecting ribosomal prokaryotic RNA 16S; on a StepOnePlus Real-Time PCR System. 16S was used as reference (housekeeping) gene.
7
Real-Time RT-PCR Analysis of Macrophages
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA from peritoneal macrophages (4×106) was extracted via the Direct-zol RNA MiniPrep Plus kit (Zymo). RNA (1 μg) was reverse transcribed to first-strand cDNA with ImProm-II (Promega) and oligo(dT) 12–18 primer, according to the manufacturer’s instructions. Real-time PCR was performed using primers for the IFNβ (sense 5’ TCC AAG AAA GGA CGA ACA TTC G 3’ and antisense 5’ TGA GGA CAT CTC CCA CGT CAA 3’), IL-10 (sense 5’ CCC AGA AAT CAA GGA GCA TT 3’ and antisense: 5’ TCA CTC TTC ACC TGC TCC AC 3’) and GAPDH gene (sense 5’ TTG ACC AAC TGC TTA GC 3’ and antisense 5’ GGC ATG GAC TGT GGT CAT GAG 3’). Amplicon specificities were compared by the presence of a single melting temperature dissociation curve after real-time RT-PCR runs. Real-time qRT-PCR was performed in the Applied Biosystems StepOne detection system (Applied Biosystems) using GoTaq qPCR Master Mix (Promega). All qRT-PCR experiments were performed 3 times, and the experimental qRT-PCR data from the experiments were normalized using GAPDH primers as an endogenous control. All expression ratios were determined by the relative gene expression ΔΔCt method using StepOne 2.0 software 2.0 (Applied Biosystems).
8
RNA Isolation, cDNA Synthesis, and RNA-Seq Library Preparation
9
Mapping E. coli Plasmid Transcripts
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA from exponentially growing plasmid-carrying E. coli strains was extracted (41 (link)). Total RNA (10 to 20 µg) was hybridized with 5′-32P-labeled ML-512 and ML-1314 primers. Reverse transcription experiments were done at 42°C using the reverse transcriptase ImProm-II (Promega). Reaction products were analyzed on an 8% polyacrylamide gel in parallel with sequencing reaction products obtained using the same primers.
10
RNA Extraction and Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted using Trizol solution (Invitrogen, Carlsbad, CA, USA) as per the manufacturer’s instructions. First, 1 μg of total RNA was subjected to the generation of cDNA using the Improm-II reverse transcription system (Promega, Madison, WI, USA), and the subsequent PCR was performed with primer sets for rpLF (5′-ATG TCG CAT TTG TGA GAG ATT-3′ and 5′-CTC GCT TGG GCA TTT GGT T-3′) and yG3PDH (5′-GTA ACA TCA TTC CAT CTT CC-3′ and 5′-TCT TCA GTG TAA CCC AAA AC-3′). The PCR amplification was performed for 35 cycles (94 °C for 30 s, 55 °C for 1 min, and 72 °C for 1 min). Afterward, the PCR products were visualized with a 2% agarose gel.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!