1 μg of total RNA, isolated with GenElute™ total RNA Miniprep Kit (Sigma, Milan, Italy), was reverse transcribed as described previously [11 (link)]. For real time PCR (35 cycles), cDNA was amplified with GoTaq® qPCR Master Mix (Promega, Madison, WI, USA) along with the following primers (5 pmol each): GLUL (for 5′-TCATCTTGCATCGTGTGTGTG-3′, rev 5′-CTTCAGACCATTCTCCTCCCG-3′); RPL-15 (for 5′-GCAGCCATCAGGTAAGCCAAG-3′, rev 5′-AGCGGACCCTCAGAAGAAAGC-3′); SLC38A2 (for 5′-ATGAAGAAGGCCGAAATGGGA-3′, rev 5′-TGCTTGGTGGGGTAGGAGTAG-3′); SLC1A5 (for 5′-TGGTCTCCTGGATCATGTGG-3′, rev 5′-TTTGCGGGTGAAGAGGAAGT-3′); SLC7A5 (for 5′-GTGGACTTCGGGAACTATCACC-3′, rev 5′-GAACAGGGACCCATTGACGG-3′). Quantitative PCR was performed in a 36-well Rotor Gene 3000 (Corbett Research, Rotor-Gene™ 3000, version 5.0.60, Mortlake, Australia). Each cycle consisted of a denaturation step at 95 °C for 30 s, followed by separate annealing (30 s, 55–58 °C) and extension (30 s, 72 °C) steps. Fluorescence was monitored at the end of each extension step. A no-template, no-reverse transcriptase control was included in each experiment. At the end of the amplification cycles a melting curve analysis was added. Data analysis was performed according to the Relative Standard Curve Method. [51 (link)] Expression data were normalized to RPL-15 mRNA expression.
Rotor gene 3000
Manufactured by Qiagen
Sourced in Australia, Germany, United Kingdom, United States, Japan, Canada, China
The Rotor-Gene 3000 is a real-time PCR cycler designed for nucleic acid amplification and detection. It features a rotating sample carousel that can accommodate 36 reaction tubes. The system is capable of performing real-time quantitative PCR analyses.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (44 mentions)
Rneasy mini kit, by Qiagen (26 mentions)
Trizol, by Thermo Fisher Scientific (21 mentions)
Dnase, by Thermo Fisher Scientific (16 mentions)
High capacity cdna reverse transcription kit, by Thermo Fisher Scientific (12 mentions)
Rotor gene sybr green pcr kit, by Qiagen (11 mentions)
Sybr green, by Thermo Fisher Scientific (9 mentions)
Faststart sybr green master, by Roche (8 mentions)
Sensifast cdna synthesis kit, by Meridian Bioscience (8 mentions)
M mlv reverse transcriptase, by Thermo Fisher Scientific (7 mentions)
Taqman gene expression assay, by Thermo Fisher Scientific (7 mentions)
Sybr select, by Thermo Fisher Scientific (6 mentions)
M mlv, by Promega (6 mentions)
Tri reagent, by Merck Group (6 mentions)
M mlv reverse transcriptase, by Promega (6 mentions)
Rnaeasy mini kit, by Qiagen (6 mentions)
Nanodrop nd 1000, by Thermo Fisher Scientific (6 mentions)
Nanodrop 2000 spectrophotometer, by Thermo Fisher Scientific (6 mentions)
Dnase 1, by Thermo Fisher Scientific (5 mentions)
Quantitect reverse transcription kit, by Qiagen (5 mentions)
321 protocols using rotor gene 3000
1
Quantitative PCR analysis of amino acid transporters
2
Quantification of Gene and microRNA Expression in Adipose Tissue
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from epididymal adipose tissue using TRIzol reagent (GeneAll Biotechnology, Seoul, Korea) according to the manufacturer’s instructions. cDNA was synthesized from total RNA using a Moloney Murine Leukemia Virus (M-MLV) Reverse Transcriptase kit (Bioneer Co., Daejeon, Korea). Real-time qPCR was performed using Rotor Gene 3000 (Corbett Research, Mortlake, N.S.W., Australia) and AccuPower 2X Greenstar qPCR MasterMix (Bioneer Co., Daejon, Korea). Primers used for real-time qPCR analysis are described in Supplementary Table S2 . Data analysis was conducted by the 2−ΔΔCt method. β-actin was used as the reference gene for normalization.
For the analysis of miR expression, cDNA was synthesized using a miRNA cDNA Synthesis Kit with Poly (A) Polymerase Tailing (ABM Inc., Richmond, BC, Canada). The synthesized cDNA was amplified using the EvaGreen miRNA qPCR Master Mix (ABM Inc.). Quantification of miRs was carried out using miR-21, miR-132, and U6 specific primers (ABM Inc). Real-time qPCR amplification was performed using the Rotor Gene 3000 (Corbett Research). Levels of miR-21 and miR-132 were normalized to U6 snRNA and determined using the 2−ΔΔCt method.
For the analysis of miR expression, cDNA was synthesized using a miRNA cDNA Synthesis Kit with Poly (A) Polymerase Tailing (ABM Inc., Richmond, BC, Canada). The synthesized cDNA was amplified using the EvaGreen miRNA qPCR Master Mix (ABM Inc.). Quantification of miRs was carried out using miR-21, miR-132, and U6 specific primers (ABM Inc). Real-time qPCR amplification was performed using the Rotor Gene 3000 (Corbett Research). Levels of miR-21 and miR-132 were normalized to U6 snRNA and determined using the 2−ΔΔCt method.
3
Quantitative Assessment of HCV and HBV
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The HCV RNA was assessed quantitatively using a real-time PCR technique (Real-TM Quant DX, Sacace Biotechnologies) with a Rotor-Gene 3000 analyzer (Corbett Research). The analytical sensitivity (limit of detection (LOD)) of the assay was 13 IU/mL. The linear range of the measurement was 13 - 108 IU/mL. In relevant cases, the HCV genotype was determined using a HCV Genotype 2.0 Assay (LiPA) (Siemens Healthcare Diagnostics). The HBV DNA was assessed quantitatively using a real-time PCR technique (GeneProof Hepatitis B Virus (HBV) PCR kit, GeneProof) with a Rotor-Gene 3000 analyzer (Corbett Research). The analytical sensitivity (limit of detection (LOD)) of the assay was 26 IU/mL.
4
Quantitative real-time RT-PCR analysis of gene expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from mycelia transferred to medium containing glucose or no carbon source for 16 hr as described previously (Reinert et al. 1981 (link)) and treated with the Ambion Turbo DNA-free Kit (Invitrogen, AM1907, Carlsbad, CA) prior to quantification in a SpectraMax M2e Microplate Reader (Molecular Devices, M2E, Sunnyvale, CA). The primers used in qRT-PCR experiments were designed using the Primer3 program (http://frodo.wi.mit.edu/primer3/ ) and are listed in Table S1 . Each primer pair was first tested with serial dilutions of RNA to determine the linear range of the qRT-PCR assays using the SuperScript III Platinum SYBR Green One-Step qRT-PCR Kits (Invitrogen, 11736). The experiments were performed using a Corbett CAS1200 liquid handling robot and Corbett Rotor-Gene 3000 real-time thermal cycler (QIAGEN, RG3000, Hilden, Germany). In the assays to determine relative transcript levels, 1 ng of total RNA was added to each reaction. A minimum of three independent RNA preparations were assayed.
5
Quantitative PCR Analysis of mRNA Abundance
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
mRNA abundance was determined using cDNA prepared from RNA, isolated from duodenal biopsies. Real-time PCR assays were performed using SYBR Green JumpStart Taq ReadyMix for QPCR (Sigma Aldrich). Assays were performed in triplicate using a Rotorgene 3000 (Qiagen, Crawley, UK) and relative abundance was calculated using RG-3000 comparative quantification software. Real-time amplification of RNA polymerase IIA (POLR2A) was carried out simultaneously as the control reference (see Table S2 for qPCR primer sequences).
6
Quantification of XBP1 Splicing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was extracted and reverse transcribed as previously described (Cox et al., 2011 ). Protocols for quantification of splicing of XBP1 were described previously (Cox et al., 2011 ; Brown et al., 2016 (link)). qPCRs were run on a Rotorgene 3000 (Qiagen, Crawley, UK) using GoTaq G2 Flexi DNA polymerase (Promega, Southampton, UK; cat. no. M7801) and analyzed as described before (Brown et al., 2016 (link)). Primer sequences are listed in Table 2 or have been reported before (Brown et al., 2016 (link)). Amplification of a single PCR product was confirmed by recording the melting curves after each PCR. The amplification efficiencies for all qPCRs were ∼0.75 ± 0.05. Results represent the average and SE of three technical repeats. qPCR results were confirmed by at least one other biological replicate.
7
Relative mRNA Expression Quantification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Relative mRNA expression in the intestine
was determined by quantitative real-time PCR (qPCR). cDNA was prepared
from total RNA as described above and diluted to 5 ng/μL. Primers
to rabbit SGLT1, β-actin (ACTB), RNA polymerase II (POLR2A),
and β-2-microglobulin (B2M) were designed using Primer-BLAST18 (link) and purchased from Eurogentec (seeTable 1 ). Each qPCR reaction
consisted of 25 ng of cDNA template, 1X SYBR green JumpStart Taq ReadyMix,
and 900 nM of each primer in a total volume of 25 μL. The PCR
cycling consisted of initial denaturation at 95 °C for 2 min
followed by 45 cycles of 95 °C for 15 s and 60 °C for 1
min. Assays were performed in triplicate using a RotorGene 3000 (Qiagen)
with relative abundance calculated using RG-3000 comparative quantification
software (Qiagen). Abundance of SGLT1 mRNA was normalized to the genomic
mean of ACTB, POLR2A, and B2M housekeeping genes, the expression of
which did not change throughout the study. qPCR assays without the
RT step were routinely employed as negative controls and showed no
amplification. Melt curve analysis showed no primer dimer formation
in the assays. PCR amplicons were cloned into pGEM-T easy vectors
and sequenced to confirm veracity.
was determined by quantitative real-time PCR (qPCR). cDNA was prepared
from total RNA as described above and diluted to 5 ng/μL. Primers
to rabbit SGLT1, β-actin (ACTB), RNA polymerase II (POLR2A),
and β-2-microglobulin (B2M) were designed using Primer-BLAST18 (link) and purchased from Eurogentec (see
consisted of 25 ng of cDNA template, 1X SYBR green JumpStart Taq ReadyMix,
and 900 nM of each primer in a total volume of 25 μL. The PCR
cycling consisted of initial denaturation at 95 °C for 2 min
followed by 45 cycles of 95 °C for 15 s and 60 °C for 1
min. Assays were performed in triplicate using a RotorGene 3000 (Qiagen)
with relative abundance calculated using RG-3000 comparative quantification
software (Qiagen). Abundance of SGLT1 mRNA was normalized to the genomic
mean of ACTB, POLR2A, and B2M housekeeping genes, the expression of
which did not change throughout the study. qPCR assays without the
RT step were routinely employed as negative controls and showed no
amplification. Melt curve analysis showed no primer dimer formation
in the assays. PCR amplicons were cloned into pGEM-T easy vectors
and sequenced to confirm veracity.
8
Quantitative Analysis of miR-15a Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA, including miRNA, was extracted using TRIzol® reagent (Invitrogen; Thermo Fisher Scientific, Inc.) according to the manufacturer's protocol. Reverse transcriptase and oligo (dT) primers were employed to synthesize cDNA from 5 µg total RNA in a volume of 12 µl, and then the reaction mixture was finally adjusted to 20 µl for RT-qPCR. RT-qPCR analysis was performed on a Rotor-Gene 3000 real-time cDNA detection system (Qiagen, Inc., Valencia, CA, USA) to examine the expression of miR-15a with SYBR®−Green (Invitrogen; Thermo Fisher Scientific, Inc.). qPCR was performed under the following conditions: Initiation at 95°C for 2 min, followed by 40 cycles of denaturation at 95°C for 10 sec; annealing at 60°C for 30 sec; and extension at 70°C for 45 sec. The quantitation cycle (Cq) value was set within the exponential phase of PCR and normalized against a U6 housekeeping gene (24 (link)). The following primer sequences were used: rno-miR-15a-5p-RT, CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGAAACCATT (reverse primer); rno-miR-15a-5p-F, AGCTGGGTAGCAGCACATAATGGTTT (forward primer).
9
Quantifying EBV DNA in PBMCs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total DNA was extracted from PBMC using the QIAmp DNA blood mini kit (Qiagen,
Hilden, Germany) then subjected to a real-time PCR assay on the Rotorgene 3000
(Qiagen). DNA from the Namalwa cell line (two copies of EBV per cell) was used to
set up a standard curve to determine the unknown EBV copies of the samples in the
assay. The primers and probe were directed towards a conserved portion of the
BamH1W segment of the EBV genome.36 (link)
Hilden, Germany) then subjected to a real-time PCR assay on the Rotorgene 3000
(Qiagen). DNA from the Namalwa cell line (two copies of EBV per cell) was used to
set up a standard curve to determine the unknown EBV copies of the samples in the
assay. The primers and probe were directed towards a conserved portion of the
BamH1W segment of the EBV genome.36 (link)
10
Gene Expression Analysis of BEAS-2B Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
BEAS-2B and siRNA-transfected BEAS-2B cells were seeded separately in 96-well plates at 3 × 104 cells per well in triplicate for each cell group. After exposure to the treatments (DEP, sulforaphane, EBSS and bafilomycin), total RNA was extracted from the cell pellet using 700 μL of Qiazol reagent (Qiagen) with an extraction column (RNeasy Mini kit Qiagen), according to the manufacturer’s instructions. The RNA was stored at −80 °C. The complementary DNA (cDNA) was synthesized using 200 ng of total RNA incubated in the presence of 4 μl SuperScript VILO Master Mix (Invitrogen) according to the manufacturer’s instructions. All samples were processed for RT-PCR in quadruplicate in a Rotor Gene 3000 instrument (Qiagen). The analysis was performed by calculating the relative quantity of each gene of interest in relation to a housekeeping gene, as indicated in the model described by Livak and Schmittgen48 (link) and using the 2−ΔΔCT formula. The primer sequences are listed in Table 4 . All 2−ΔΔCT values are informed in Supplementary Material.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!