Primescrip rt reagent kit

Total RNA was extracted from Tregs isolated from mouse spleens with an AxyPrep total RNA extraction kit (Axygen, New York, NY, United States). cDNA was synthesized using a PrimeScrip RT reagent kit (Takara, Shiga, Japan). All primers were obtained from Tsingke (Beijing, China), and the sequences are listed in Supplementary Table S1. Then, RT-qPCR was performed using SYBR Green Supermix on a CFX96 RT-qPCR detection system (BioRad, Hercules, CA, United States). The expression levels of mRNA transcripts related to Treg functions and glucose metabolism were normalized to β-actin mRNA levels.

RNAiso Plus (9108Q, Takara, China) or RNAiso for Small RNA (9753Q) were used to isolate total RNA or miRNA, as required. Reverse transcription step was refered to the instructions of PrimeScrip RT reagent Kit (RR037Q) produced by Takara, China. The RT-qPCR detection was constructed in the Mx3000P Real-Time QPCR System (Agilent, USA) with Takara TB Green Premix Ex Taq II (RR820Q, China), followed by the conditions set as below: pre-denaturation (95°C, 3 min), denaturation (95°C, 15 s) and annealing (60°C, 1 min) for a total of 40 cycles, and finally extended (68°C, 7 min). GAPDH or U6 were used as control for mRNA or miRNA, and the results were quantified in the form of 2^-ΔΔCt method [16 (link)]. Sequences of the primers were listed as follows (5’-3’). LINC00174: (GGCCCAACACTTCCCTCAAA, CAGGGAGAAACGACCTGGAG); miR-3127-5p:(ATCAGGGCTTGTGGAATGGG, GTATCCAGTGCGTGTCGTGG); E2F7: (AAAGGGACTATTCCGACCCAT, ACTTGGATAGCGAGCTAGAAACT); SHBG: (GCCCAGGACAAGAGCCTATC, CCTTAGGGTTGGTAT CCCCATAA); GAPDH: (GCAAGAGCACAAGAGGAAGA, ACTGTGAGGAGGGGAGATTC); U6: (CTC GCTTCGGCAGCACA, AACGCTTCACGAATTTGCGT).

Samples of splenic tissue (30 mg/rat) were snap-frozen with liquid N₂, and then immediately ground into powder using a ceramic mortar. The total RNA from each sample was extracted with an Animal Total RNA Isolation Kit (Sagon Biotech, Shanghai, China) according to manufacturer instructions. After confirming the isolated RNA concentration and purity using a NanoDrop One system (Thermo Fisher Scientific, Waltham, MA, USA; OD260/280 ≈ 1.9–2.0), triplicate aliquots (each 1 µg) were removed, loaded into wells, and the cDNA of each prepared using a PrimeScrip RT reagent kit (Takara, Tokyo, Japan). Thereafter, qRT-PCR was performed using a SYBR Premix ExTaq (Takara, Tokyo, Japan) and a CFX96 thermal cycler (BioRad, Hercules, CA, USA). The primers used to analyze the genes of interest were designed from NCBI’s genBank and are shown in Table 7. The relative gene expression in each sample was normalized to an internal control (β-actin); data analysis was done using the 2^−ΔΔCt method [44 (link)]. All samples were evaluated in triplicate.

Total RNA was extracted from cultured cell lines using TRIzol reagent (Cat# 9108; TaKaRa, Dalian, China). The ratio of absorbance at 260 and 280 nm (the A260/280 ratio) was used to evaluate the purity of RNA. Subsequently, cDNAs were synthesized by using the PrimeScrip™ RT reagent Kit (Cat# RR047A; TaKaRa, Dalian, China) from 1 μg of total RNA in 20 μl of reaction volume. 2×TB^® Green qPCR Master Mix (Cat# RR820Q; TaKaRa, Dalian, China) was used for qRT-PCR with Roche Lightcycler 480 RT-PCR System. GAPDH fragment was used as an internal control for normalization of the data before calculation using the 2^−ΔΔCt method. Three independent replicates were conducted for each experiment. The primers used are listed in Table S2.

Quantitative RT-qPCR was used to validate the different expression levels of ncRNAs in moDCs from AIH patients and healthy controls. Total RNA was extracted from moDCs using TRIzol reagent (Ambion, Thermo Fisher Scientific, United States). cDNA was synthesized from 1 μg of extracted total RNA with the PrimeScrip RT reagent kit (Takara, Shiga, Japan) and amplified by real-time qPCR with SYBR Green Supermix on a CFX96 RT-qPCR detection system (BioRad, Hercules, CA, United States). The expression levels of ncRNAs were normalized to actin expression level. All primers were obtained from Tsingke (Beijing, China).