Sacii

Hbl proteins (rHbl B and L2 with N-terminal and rHbl L1 with C-terminal strep tag) were overexpressed in E. coli BL21 (DE3) and purified as described earlier [26 (link)]. In the present study, a system for separation of the tag was established. The genes hblC (L2), hblD (L1) and hblA (B) were amplified by PCR using pASK-IBA5+hblC, pASK-IBA3+hblD and pASK-IBA5 + hblA [26 (link)] as templates, as well as the primer pairs L1_7+_fw (ATATCCGCGGTGCACAAGAAACGACCG) and L1_7+_rev (ATATGTCGACCTACTCCTGTTTAAAAGCAATATC), L2_7+_fw (ATATCCGCGGTCAAGCAGAAACTCAACAAGA) and L2_7+_rev (ATATGTCGACTCAAAATTTATACACTTGTTCTTC), and B_7+_fw (ATATCCGCGGTGCAAGTGAAATTGAACAAAC) and B_7+_rev (ATATGTCGACCTATTTTTGTGGAGTAACAGTTTC). Using the enzymes SacII and SalI (New England Biolabs, Frankfurt, Germany; restriction sites underlined in the primer sequences), the three genes lacking the sequences for the N-terminal signal peptides for secretion [64 (link),65 (link)] were cloned into pASK-IBA7+ (IBA Lifesciences, Göttingen, Germany). The constructs were sequenced using the primers pASK-IBA-seq-fw (CACTCCCTATCAGTGATAG) and pASK-IBA-seq-rev (GCACAAT GTGCGCCAT). Proteins were again overexpressed in E. coli BL21 (DE3) and purified via their N-terminal strep tag as described earlier [26 (link)].

An mCherry-Rab6A′ expression plasmid was made by subcloning the Rab6A′ open reading frame from a GFP-Rab6A′ expression plasmid into a pmCherry-C1 (Takara Bio, Kusatsu City, Japan) using SacI (New England Biolabs, Ipswich, MA, United States) and SacII (New England Biolabs) restriction sites. The following expression plasmids were used: EGFP-Rab6A, EGFP-Rab6A′, mCh-Rab6A’, and EGFP-KDELR.

Total genomic DNA was digested with SacII (New England BioLabs) for strains containing pBR322-derived plasmids or NheI (New England BioLabs) for pCB104-derived plasmids. In both cases, plasmids lack restriction sites for these enzymes. Samples were then extracted with one volume of chloroform before equal cell equivalents were electrophoresed through 1.0% agarose gel in 1× TBE (Tris-borate-EDTA, pH 8.0) at 1 V/cm. DNA in the gels was transferred to a Hybond N+ nylon membrane, and the plasmid DNA was detected by probing with either ³²P-labeled pBR322 or pCL01 plasmid DNA prepared by random-primer labeling (Agilent Technologies) using α³²P-labeled-dCTP (3000 Ci/mmol; PerkinElmer) and visualized using a STORM PhosphorImager with its associated ImageQuant analysis software (Amersham Biosciences).

Mosquitoes with CHIKV-positive saliva were selected from mosquitoes inoculated with CHIK_IC, CHIK_IC^P398A, CHIK_IC^PPR401AAA, CHIK_IC-FG_N or CHIK_IC-FG_C. A selection of mosquitoes was made to represent each replicate experiment. Thirty μl of mosquito sample supernatant was used to inoculate a well of a 96-wells plate pre-seeded with C6/36 cells. At 3 days post infection RNA was isolated with TRIzol reagent (Invitrogen) and 300 ng total RNA was subjected to one-step RT-PCR with primers 3,4 using SuperScript III one-step RT-PCR system with Platinum Taq DNA polymerase (Invitrogen) following the manufacturer’s protocol. RT-PCR products were observed on agarose gel to confirm the infection of mosquitoes with CHIKV. To investigate the presence and preservation of the expected mutations, RT-PCR products were subjected to digestion with SacII (NEB), NotI (NEB) or ApeKI (NEB) according to the manufacturer’s protocol. Digestions were observed on agarose gel.

A single targeting vector was generated to produce Hspb8^K141N KI and Hspb8 KO transgenic mouse lines. Briefly, the BAC clone bMQ-191J17 (Geneservice, Cambridge, UK) containing the full length mouse Hspb8 genomic DNA was used as starting material. The Neomycin (Neo) selection gene, floxed by Flp recombinase target (FRT) sites and followed by a loxP site, was retrieved from a pPGK-loxPFRT-Neo-FRT plasmid (gift from D. J. van Hengel, VIB Department for Molecular Biomedical Research, Ghent). Through PCR, a loxP site upstream of exon 2 was added, as well as specific restriction sites to allow further cloning, Southern blot analysis, and genotyping. The restriction enzymes used were AatII, BamHI, EcoRV, HindIII, MluI, NotI, SacII, SexAI, and XhoI (New England Biolabs, Ipswich, MA, USA). In a first step, all fragments were cloned individually in a pCR2.1_TOPO vector (Life Sciences, Little Chalfont, UK). Next, in vitro mutagenesis was performed to insert the K141N (c.423 G > C) mutation in the exon 2 of the Hspb8 gene. The final targeting vector contained (1) the K141N point mutation in exon 2 of the Hspb8 gene; (2) the Neo gene cassette, downstream of hspb8 exon 2; (3) two loxP sites to allow the excision of exon 2 and the Neo cassette to generate a functional Hspb8 KO mouse line.

L. plantarum NCIMB8826 ndh2, pplA, and narGHIJ deletion mutants were constructed by double-crossover homologous recombination with the suicide plasmid pRV300 (Leloup et al., 1997 (link)). For mutant construction, upstream and downstream flanking regions of these genes were amplified using the A/B and C/D primers, respectively, listed in Supplementary file 5. Splicing-by-overlap extension (SOEing) PCR was used to combine PCR products as previously described (Heckman and Pease, 2007 (link)). PCR products were digested with restriction enzymes EcoRI, SacI, SacII, or SalI (New England Biolabs, Ipswich, MA, USA) for plasmid ligation and transformation into E. coli DH5α. The resulting plasmids were then introduced to L. plantarum NCIMB8826 by electroporation. Erythromycin-resistant mutants were selected and confirmed for plasmid integration by PCR (see Supplementary file 5 for primer sequences). Subsequently, deletion mutants were identified by a loss of resistance to erythromycin, PCR (see Supplementary file 5 for primer sequences) confirmation, and DNA sequencing (http://dnaseq.ucdavis.edu).

The pX330-U6-Chimeric_BB-CBh-hSpCas9 plasmid (a gift from Feng Zhang; Addgene plasmid #42230) was modified to express a bicistronic peptide containing Cas9 and Cre as follows. pX330 was sequentially modified to accept a 2.4 kb Cas9-P2A-Cre fragment from pSECC (a gift from Tyler Jacks; Addgene plasmid #60820) first by an EcoRI (New England Biolabs) digestion with a subsequent fill-in reaction by DNA polymerase and then a AccIII restriction digest. The 2.4 kb insertion fragment was generated from pSECC by a restriction digest with AccIII (Promega) and SacII (New England Biolabs). Ligation of this fragment into the pX330 modified plasmid was performed using T4 DNA Ligase (Invitrogen) in an overnight reaction at 16°C. The ligated product was then used to transform competent bacteria. sgRNAs targeting Trim24, Kif5b, Tpm3, Ret and Ntrk1 were designed using the Zhang lab CRISPR design tool (crispr.mit.edu) and are presented in Table S1. The pX330+Cre plasmid was digested with BbsI (New England BioLabs) and ligated to annealed and phosphorylated sgRNA oligonucleotides (Integrated DNA Technologies). Ligated plasmids were transformed into DH5α E.coli (Life Technologies). The PX330-Alk-Eml4 plasmid was kindly provided by Andrea Ventura (Maddalo et al., 2014 (link)).