Frozen adipose tissue was ground in liquid nitrogen using mortar and pestle. Ground tissue was immediately placed in a 1.5 ml tube containing Trizol. Before loading the sample into the column, the tube was spun and the lipid layer was removed. Total RNA was extracted using Direct-zol RNA MiniPrep Plus (Zymo Research, Irvine, CA) with in-column DNase I treatment to eliminate DNA contamination. cDNA synthesis and qRT-PCR were performed as previously described [24 (link)]. Primers were designed using VectorNTI software (Life Technologies, Grand Island, NY) and synthesized by IDT (Coralville, IA). Validation and specificity was performed using the Basic Local Alignment Search Tool (BLAST) (https://blast.ncbi.nlm.nih.gov/Blast.cgi ). Primers were verified to have no SNPs using the dbSNP track available in Genome Browser. All mRNA primer sequences and amplification efficiencies can be found in Supplementary Table 1 . All gene expression was normalized to Rpl7a due to its widespread use and proven stability [29 (link), 30 (link)].
Vector nti software
Manufactured by Thermo Fisher Scientific
Sourced in United States, France
Vector NTI is a software suite designed for bioinformatics and molecular biology applications. It provides tools for DNA and protein sequence analysis, primer design, and in silico cloning.
Automatically generated - may contain errors
Lab products found in correlation
Rneasy mini kit, by Qiagen (7 mentions)
Trizol reagent, by Thermo Fisher Scientific (4 mentions)
Pgem t easy vector, by Promega (3 mentions)
Aligner, by CodonCode (3 mentions)
Steponeplus real time pcr system, by Thermo Fisher Scientific (3 mentions)
Sybr green pcr master mix, by Thermo Fisher Scientific (3 mentions)
Iscript cdna synthesis kit, by Bio-Rad (3 mentions)
Direct zol rna miniprep plus, by Zymo Research (2 mentions)
Abi prism 7900 sequence detection system, by Thermo Fisher Scientific (2 mentions)
Absolute qpcr sybr green rox mix, by Thermo Fisher Scientific (2 mentions)
Sds 2, by Thermo Fisher Scientific (2 mentions)
Taq dna polymerase, by Thermo Fisher Scientific (2 mentions)
Beacon designer software, by Premier Biosoft (2 mentions)
Qtower 2, by Analytik Jena (2 mentions)
Innumix qpcr mastermix sygreen, by Analytik Jena (2 mentions)
Quantitect reverse transcription kit, by Qiagen (2 mentions)
Nucleospin rna kit, by Macherey-Nagel (2 mentions)
Phusion flash pcr master mix, by Thermo Fisher Scientific (2 mentions)
Superscript 3 reverse transcriptase, by Thermo Fisher Scientific (2 mentions)
Pmd19 t simple vector, by Takara Bio (2 mentions)
117 protocols using vector nti software
1
Robust RNA Extraction from Frozen Adipose Tissue
2
Characterization of HCN4 Variants
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genomic DNA was extracted from whole blood using the QIAmp DNA Blood Mini Kit (Qiagen) following the supplier’s instructions. All HCN4 exons were amplified by PCR using intronic HCN4-specific primers [25 (link)], 125 ng genomic DNA, 5–8% DMSO, and Phusion DNA Polymerase (Thermo Fisher Scientific). PCR conditions were 30 s at 98 °C (1 cycle), 10 s at 98 °C, 30 s at 60–70 °C, 15 s at 72 °C (30 cycles), and 2 min at 72 °C (1 cycle). Amplificates were separated by agarose gel electrophoresis, purified with the MinElute Gel Extraction Kit (Qiagen), and analyzed by Sanger sequencing. The electropherograms were compared to wild-type human HCN4 using VectorNTI software (Life Technologies).
In vitro transcription and injection of cRNAs into Xenopus laevis oocytes was performed as described before [37 ]. Site-directed mutagenesis was done as previously described [15 ]. GenBank accession numbers of cDNAs were NM_005477 (human HCN4) and NM_173152 (rat PEX5R/Trip8b). All cDNAs were verified by sequencing.
In vitro transcription and injection of cRNAs into Xenopus laevis oocytes was performed as described before [37 ]. Site-directed mutagenesis was done as previously described [15 ]. GenBank accession numbers of cDNAs were NM_005477 (human HCN4) and NM_173152 (rat PEX5R/Trip8b). All cDNAs were verified by sequencing.
3
Reverse Transcription and Sequencing of Citrus Tristeza Virus Genomes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The methylmercury hydroxide denatured dsRNA of T36-CA or T30-CA described above was reverse transcribed to generate the first strand cDNA. The RT reaction was performed using the Maxima H minus reverse transcriptase (Thermo Scientific) and the oligo primer CTV30-AC according to the manufacturer’s instructions. CTV30-AC and other oligo primers used for PCR amplification are listed in Additional file 1 : Table S1. The 5′ fragment (nt 1 to 8391) of T36-CA was amplified by PCR using the oligo primers CTV34-AC and CTV39-AC, and the 3′ fragment (nt 7800 to 19,292) was PCR-amplified using oligo primers CTV38-AC and CTV35-AC. The 5′ fragment (nt 1 to 8430) of T30-CA was amplified by PCR using the CTV32-AC and CTV37-AC primers, and the 3′ fragment (nt 7584 to 19,259) was PCR-amplified using CTV36-AC and CTV33-AC primers. The Expand 20 Kb plus PCR system (Roche) was used for the PCR-amplification. The RT-PCR products were gel-purified, cloned into pGem T Easy (Promega) and transformed into E. coli, JM109 (Promega), and several cDNA clones of each fragment were sequenced as described above. The nt sequences of full-length CTV genomes were assembled using the Vector NTI software (Life Technologies), and the complete sequences of T36-CA and T30-CA were deposited in the NCBI GenBank database with accession nos. MH279617 and MH279618, respectively.
4
Phylogenetic Analysis of Oleosins
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
OLE sequences from other organisms were obtained from database searches using the keyword “oleosin” and BlastP searches [43] (link), [44] (link) against the National Center for Biotechnology Information (NCBI)'s non-redundant protein sequence databases (http://blast.ncbi.nlm.nih.gov/Blast.cgi ) using tung tree OLE sequences. The properties and amino acid compositions of OLE were analyzed using Vector NTI software (Life Technologies, Carlsbad, CA) [45] (link). Statistics were performed using Microsoft Excel. Phylogenetic analysis for studying the presumed evolutionary relationships among the OLE proteins was performed using the Vector NTI software based on the neighbor-joining method of Saitou and Nei [46] (link). Multiple sequence alignment was performed using the ClustalW algorithm [47] (link), [48] (link) of the AlignX program of the Vector NTI software. This method is based on algorithms that assign scores to aligned residues and detect sequence similarities. Identical amino acid residues in alignment have higher scores than those not identical and less similar residues.
5
Comprehensive RNA Extraction from Adipose Tissue
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Frozen tissue was ground in liquid nitrogen and placed in a 1.5 ml tube containing Trizol. Before loading the adipose sample into the column, the tube was spun and the lipid layer was removed. Total RNA was extracted using Direct-zol RNA MiniPrep Plus (Zymo Research, Irvine, CA) with in-column DNase I treatment to eliminate DNA contamination. cDNA synthesis and qRT-PCR were performed as previously described [70 (link)]. Primers were designed (VectorNTI software; Life Technologies, Grand Island, NY), validated for specificity (Basic Local Alignment Search Tool; BLAST; https://blast.ncbi.nlm.nih.gov/Blast.cgi ), and synthesized (IDT; Coralville, IA). All mRNA primer sequences and amplification efficiencies can be found in Supplementary Table S1 .
6
PEDV S1 Gene Sequencing Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For select samples, it was planned to conduct nucleic acid sequencing of the PEDV S1 gene. Specifically, fragments of the S1 domain of the spike gene were amplified from extracted RNA. Primers 1: (5′- ATGARGTCTTTAAYYTACTTCTGG-3′), 2: (5′-CATCCTCACCWGCACTAGTAAC-3′), 3: (5′- GTTGTGCTATGCAATATGTTTAY-3′), 4: (5′-TGAAATTAATTGTGACAGCATC-3′), 5: (5′ -TTGTCATCACCAAGTAYGGTG -3′), 6: (5′- CTAAAAGACAGGTAATCATTAACAG- 3′), 7: (5′- CTGTGTTGACACTAGACAATTTAC- 3′), 8: (5′- CATACTAAAGTTGGTGGGAATAC- 3′) were designed to anneal to conserved genomic regions. Incorporation of degenerate bases maximizes the ability of the PCR to amplify genetically divergent PEDV variants between the US and UK strains. Primer pair 1 and 2 obtained a PCR product size of 670 bp, primer pair 3 and 4 obtained a PCR product size of 678 bp, primer pair 5 and 6 obtained a PCR product size of 565 bp and primer pair 7 and 8 obtained a PCR product size of 745 bp. Fragments were assembled sing the Vector NTI Software (Life Technologies, Waltham, MA, USA) for a complete S1 domain. QIAGEN One-Step Master Mix (Valencia, CA, USA) was used per kit instructions with an annealing temperature of 58°C for 30 seconds.
7
Protein Sequence Alignment and Fluorescent Labeling for P2X4
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The protein sequences of zfP2X4.1 (RefSeq accession no. NP_705939.1 ), mouse P2X4 (RefSeq accession no. NP_035156.2 ), and human P2X4 (RefSeq accession no. NP_002551.2 ) were aligned using Vector NTI software (Life Technologies). The sequences were annotated based on conservation between the three species. In Fig. 1 B , nonsimilar regions are shown in black, conserved regions are in blue, identical regions are in red, and weakly similar regions are in green. pHluorin was inserted in stretches of five or more nonconserved residues in the extracellular domain. 10 such regions have been annotated previously based on the closed zfP2X4.1 crystal structure (Kawate et al., 2009 (link)). We avoided variable regions that were close to the ATP-binding pocket, subunit interaction surfaces, or the ion permeation pathway (Kawate et al., 2009 (link); Hattori and Gouaux, 2012 (link)). These regions are not shown in Fig. 1 B .
8
PCR Primer Design and Cloning Techniques
9
Tick Identity Confirmation by Molecular Methods
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
In the laboratory, tick identity was confirmed by molecular methods. We extracted DNA from at least five specimens from each den using the DNeasy Blood & Tissue kit (Qiagen, Hilden, Germany). PCR was performed on the rrs locus as previously described with the following primer pairs 16s + 1: CTGCTCAATGATTTTTTAAATTGC and 16s-1: CCGGTCTGAACTCAGATCATGTA [6 (link),9 (link)]. Amplicons were Sanger sequenced by GeneWiz (South Plainfield, New Jersey, USA) and the data were assembled and trimmed using Vector NTI software (Life Technologies, Carlsbad, CA, USA).
10
Cloning and Tagging PHT1 and PHO84 Transporters
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The coding sequences of PHT1 transporters SiPHT1;1, 1;2, 1;3, 1; 4, 1;7 and 1;8 were PCR amplified from genomic DNA (no introns present for these genes) and cloned into pDD-GFP-242 (link) using SpeI/AgeI sites to generate C-terminal GFP tagged versions as PHO84-GFP had previously been shown to be functional43 (link). The coding sequence of PHO84 of Saccharomyces cerevisiae (ScPHO84) was amplified from the genomic DNA of S. cerevisiae and cloned into pDDGFP-2 using SpeI/XmaI sites. All clones were confirmed by sequencing. The details of cloning primers are given in Supplementary Table S1 . All these clones were confirmed by Sanger sequencing (Source Bioscience, UK) before moving onto the yeast complementation experiments. The plasmid maps of these clones were constructed using Vector NTI software (Life Technologies, NY, USA) and are included as Supplementary Figures S5 to S12 .
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!