We performed in situ RNA hybridization following the protocol described previously [21 (link)]. Tissues were obtained from developing spikes of diploid T. monococcum (accession PI 167615) and tetraploid wheat cultivar Kronos. cDNAs obtained from T. monococcum and Kronos were used to amplify WAPO1 genes for the in vitro transcription reaction. We designed wheat A-genome specific primers appended with promoter sequences of T3 and T7 (S1 Table ). Probes were synthesized using T3 (sense probe) or T7 (antisense probe) RNA Polymerase (Roche) and labelled with Digoxigenin-11-UTP (Roche). The forward primer P3-WM-APO1-T3-F1400 starts 57 bp upstream of the stop codon and two alternative reverse primers P4-WM-APO1-T7-R1649 and P5-WM-APO1-T7-R1843 end in the 3’ UTR and include a total of 266 and 458 bp respectively (S1 Table ). The P3-P4 and P3-P5 probes showed the same specificity. The color reaction was stopped at 48 or 72 hours, and images were taken by Nikon Ti Microscope equipped with a DS-Fi2-U3 camera.
Rna polymerase
Manufactured by Roche
Sourced in China, Australia, Germany, United States
RNA polymerase is a key enzyme involved in the transcription process, which is the first step in gene expression. It catalyzes the synthesis of RNA molecules from a DNA template. This enzyme plays a crucial role in the central dogma of molecular biology, facilitating the flow of genetic information from DNA to RNA.
Automatically generated - may contain errors
Lab products found in correlation
Dig labelling mix, by Roche (3 mentions)
Probequant g50 micro column kit, by GE Healthcare (2 mentions)
Pgem t easy vector, by Promega (2 mentions)
Digoxigenin 11 utp, by Roche (1 mentions)
Ti microscope, by Nikon (1 mentions)
Confocal laser scanning microscope, by Leica camera (1 mentions)
Dig rna labeling mix, by Roche (1 mentions)
Rneasy mini kit, by Qiagen (1 mentions)
Restriction endonuclease, by New England Biolabs (1 mentions)
Nbt bcip, by Roche (1 mentions)
Pcrii topo vector, by Thermo Fisher Scientific (1 mentions)
Qiaprep spin miniprep kit, by Qiagen (1 mentions)
Nbt bcip solution, by Roche (1 mentions)
Vista vision histobond microscope slides, by Avantor (1 mentions)
Trizol reagent, by Thermo Fisher Scientific (1 mentions)
Bm purple, by Roche (1 mentions)
Labeling mix, by Roche (1 mentions)
Fast red, by Roche (1 mentions)
Eclipse 80i, by Nikon (1 mentions)
Pgem t vector, by Promega (1 mentions)
13 protocols using rna polymerase
1
In situ RNA Hybridization of Wheat WAPO1 Genes
2
Zebrafish mpv17l2 Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
According to Thisse and Thisse (2004) , the full-length sequence of mpv17l2 (ENSDARG00000056367) was PCR amplified from liver complementary DNA (cDNA) of adult zebrafish, using the following primers, designed by Primer3 software (http://primer3.ut.ee ): mpv17l2 probe-F, 5′-CGACTCATGTTGGCTGCTC-3′; mpv17l2 probe-R, 5′-GCCCAGCGTATGTCACAAAT-3′. The PCR products were purified, then cloned into pCR2.1 TOPO vector (TOPO TA Cloning Dual Promoter Kit, Stratagene) and sequence verified. For riboprobe in vitro transcription, the constructs were linearized with the appropriate endonuclease enzyme (Promega) and transcribed with DIG-labelling mix and RNA polymerase (Roche): for antisense (working) riboprobe, HindIII/T7 RNApol; for sense (negative control) probe, NotI/SP6 RNApol. Whole-mount ISH was performed on zebrafish larvae at 3 dpf, previously fixed with 4% paraformaldehyde (PFA)/PBS and stored in 100% methanol, following standard protocols. At least 20 larvae per condition were processed in a single tube. For signal comparison, wild-type control and mpv17−/− mutant larvae were co-processed and co-stained in the same tube; controls were recognized by tail tip excision, performed after PFA fixation and before whole-mount ISH.
3
Whole Mount In Situ Hybridization Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Whole mount in situ hybridisation (WMISH) was carried out as described (Monsoro-Burq, 2007 ) with digoxigenin-labelled RNA probes. Antisense (AS) probes were generated from linearised cDNA clones in vitro with the appropriate RNA polymerase (Roche) and digoxigenin-11-UTP. The following AS probes were transcribed with T7 RNA polymerase from plasmids linearised with EcoRI unless otherwise specified: pGEM-5Zf(-)[noggin] (W. C. Smith and Harland, 1992 (link)); pBS-SK(-)[goosecoid] (Cho et al., 1991 (link)); pBS-SK(-)[chordin] (Sasai et al., 1994 (link)); pGEM1[wnt8a] linearised with BamHI (Christian et al., 1991 (link)); pBS-SK(+)[bmp4]; pCS2(+)[not1] linearised with XhoI (Dassow et al., 1993 (link)); pCMV-Sport6.ccdB[msgn1] (Gentsch et al., 2013 (link)); pGEM-T[c8orf4] linearised with NdeI; pGEM-T[Xetrov72022004] linearised with SacI; pGEM-T[K00726] linearised with SacI; and pGEM-T[cpe] linearised with ApaI and transcribed with SP6 RNA polymerase. After DNase treatment, probes were precipitated with LiCl overnight at − 20 °C and rinsed with 80% EtOH. The precipitate was dissolved with RNase-free water. The WMISH probes were diluted with hybridisation buffer (50% [v/v] formamide, 5x SSC, 1x Denhardt's, 10 mM EDTA, 1 mg/ml torula RNA, 100 μg/ml heparin, 0.1% [v/v] Tween-20% and 0.1% [w/v] CHAPS) to a final concentration of 10 ng/µl (10x stock).
4
Synthesis of Digoxigenin-Labeled RNA Probes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The following antisense digoxigenin-labeled probes were used: id1, her4.1, ascl1a and notch3 [71 (link)]. The bmp2a, bmp7a, bmp7b [72 (link)] and bmpr2b [73 (link)] probes were amplified by PCR from zebrafish embryonic cDNA (primers see Table S3 ), then cloned into the pGEM-T easy vector (Promega). bmp2b and bmp4 were kindly provided by Matthias Hammerschmidt [74 ] and bmpr1ab by Jeroen Bakkers [75 (link)]. Briefly for probe synthesis, 1 μg of each plasmid was linearized using appropriate restriction enzymes for 30 min at 37 °C. After deactivation of the restriction enzyme (see Table S4 ) at 80 °C for 5 min, the plasmid was used for in-vitro RNA transcription in the presence of DIG labelling mix (Roche) and RNA Polymerase (see Table S4 ) and incubated for 3 h at 37 °C. The reaction was stopped by adding 0.2 M EDTA, pH8 and purified using the ProbeQuant G50 Micro column kit (GE Healthcare). The probe was then diluted 1:1 using hybridization buffer [50 (link)] for storage at −20 °C.
5
In situ detection of hsa_circ_0011385
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
In situ hybridization was carried out using probes specific to the hsa_circ_0011385 sequence. Biotin-labelled specific RNA probes were transcribed from hsa_circ_0011385 PCR fragments using the biotin-labelling mix and RNA polymerase (Roche, China) according to instructions provided by manufacturers. After growth to the exponential phase, MGC-803 cells were fixed using 4% formalin. Tissue were cut into 4 μm sections and then fixed with 4% formalin. Cells and tissues were then hybridized in hybridization buffer with biotin-labeled probes specific to hsa_circ_0011385. Signals were measured by tyramide-conjugated Alexa 488 fluorochrome tyramide signal amplification (TSA) kit. The results were viewed using a Laser Scanning Confocal Microscope (Leica, Germany).
6
Whole-Mount In Situ Hybridization of Annexin Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Lungs were dissected out quickly and fixed with 4% PFA in PBS for 1 h at 4 °C, washed three times with DEPC-PBS and then dehydrated through a graded methanol series in DEPC-PBS (25%, 50%, 75%, 100%, 100%) and stored at −20 °C. Whole-mount in situ hybridization was performed as described previously50 (link). The DNA templates used for DIG-labeled probe synthesis were generated by PCR with the primers containing either the T7 or the T3 promoter. The primer sequences are: Anxa1 5′ primer: AATTAACCCTCACTAAAGGCCCTACCCTTCCTTCAATGTATC; Anxa1 3′ primer: TAATACGACTCACTATAGGCACAGAGCCACCAGGATTT; Anxa4 5′ primer: AATTAACCCTCACTAAAGGCAGAGGAACTTCTGCAGGTG; Anxa4 3′ primer: TAATACGACTCACTATAGGCAGTACTCGCTGGAACATGAA; Anxa6 5′ primer: AATTAACCCTCACTAAAGGCAGGAAGATGCCCAGGAAATAG; Anxa6 3′ primer: TAATACGACTCACTATAGGCTCAAGTCAGGCAGGGTTATG. PCR products were purified and used as templates for probe labeling. DIG-labeled RNA probes were generated using the appropriate RNA polymerase, as described in the manufacturer’s manual (Roche). The quality of labeled RNA probes was assessed by agarose gel electrophoresis. The RNA density was quantified by the ImageJ software.
7
Molecular profiling of early Pelodiscus embryos
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from stage TK18 embryos using the RNeasy Mini Kit (Qiagen). Complementary DNA (cDNA) was synthesized by reverse transcription and used as a template for polymerase chain reaction. The P. sinensis Grem1 gene was amplified with primers based on a Genbank‐deposited sequence (XM_006132689.3; fw 5ʹ–ATCGATAAGCTTGATGAGCAGGATGGTCC–3ʹ and rev 5ʹ–CTGCAGGAATTCGATCTGCAGAATCTAG–3') and cloned into the pBSII‐SK(+) vector. Probes were transcribed using T3 (Promega) RNA polymerase and DIG RNA labeling mix (Roche). P. sinensis Bmp2, Bmp4, Fgf8, Msx1, and Msx2 probes were prepared as before (Kuraku, Usuda, & Kuratani, 2005 ). In situ hybridization was performed as described for chicken embryos (Wilkinson, 1992 ).
8
Plxna3 Riboprobe Synthesis and In Situ Hybridization
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Plasmid for Plxna3 riboprobe was kindly provided by Professor Joost Verhaagen (Netherlands Institute for Neuroscience, Amsterdam). Sense and anti-sense probes were produced by restriction endonuclease (RE; New England Biolabs, USA) digest followed by in vitro RNA transcription (IVT) with digoxigenin labelled RNA (Roche, Australia) and RNA polymerase (Roche, Australia). RE used were: sense, Kpn I; anti-sense, Spe I. Riboprobes were hydrolysed for one hour at 60°C, precipitated with LiCl and 100% ethanol, resuspended in DEPC treated double deionised water (DDW), and stored at −80°C before use.
P1 and P7 retinal sections were processed for ISH with the above riboprobe using methodology previously described [27 (link)], with α-dig-AP fragments (Roche, Australia) and NBT/BCIP (Roche, Australia). Sections were differentiated in 70% ethanol if necessary, and stored in PBS before proceeding to immunohistochemistry (IHC). Sense riboprobes produced limited, diffuse staining, and all experimental runs showed positive anti-sense riboprobe staining in control tissue (adult rat cerebellum; data not shown).
P1 and P7 retinal sections were processed for ISH with the above riboprobe using methodology previously described [27 (link)], with α-dig-AP fragments (Roche, Australia) and NBT/BCIP (Roche, Australia). Sections were differentiated in 70% ethanol if necessary, and stored in PBS before proceeding to immunohistochemistry (IHC). Sense riboprobes produced limited, diffuse staining, and all experimental runs showed positive anti-sense riboprobe staining in control tissue (adult rat cerebellum; data not shown).
9
Generation of Antisense RNA Probes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The following antisense digoxigenin-labeled probes were used: id1, her4.1, ascl1a and notch3 (Armant et al., 2013) . The bmp2a, bmp7a, bmp7b (Shawi and Serluca, 2008) and bmpr2b (Monteiro et al., 2008) probes were amplified by PCR from zebrafish embryonic cDNA (primers see Table S3), then cloned into the pGEM-T easy vector (Promega). bmp2b and bmp4 were kindly provided by Matthias Hammerschmidt (Hild et al., 2000) and bmpr1ab by Jeroen Bakkers (Smith et al., 2011) . Briefly for probe synthesis, 1 μg of each plasmid was linearized using appropriate restriction enzymes for 30 min at 37°C. After deactivation of the restriction enzyme (see Table S4) at 80°C for 5 min, the plasmid was used for in vitro RNA transcription in the presence of DIG labelling mix (Roche) and RNA Polymerase (see Table S4) and incubated for 3 h at 37°C. The reaction was stopped by adding 0.2 M EDTA, pH8 and purified using the ProbeQuant G50 Micro column kit (GE Healthcare). The probe was then diluted 1:1 using hybridization buffer (Schmidt et al., 2014) for storage at -20°C.
10
Amplification and Cloning of Receptor Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To amplify Arc/Arg3.1, we used the following primers: for: 5′-CGA AGT GTC CAA GCA GGT G-3′; and rev: 5′-TGA TGG CAT AGG GGC TAA CA-3′. To amplify NO-GC, we used the following primers: for: 5′-ATC CTC TTC AGC GGC ATT GTG-3′ and rev: 5′-TGC ATT GGT TCC TTC TTG CCC-3′. To amplify GC-A, we used the following primers: for: 5′-TGT GAA ACG TGT GAA CCG GA-3′ and rev: 5′-AGG CGG ATC GTT GAA AGG G-3′. To amplify GR, we used the following primers: for: 5′-TCC CCC TGG TAG AGA CGA AG-3′ and rev: 5′-GGC TGG TCG ACC TAT TGA GG-3′. To amplify MR, we used the following primers: for: 5′-GAG ATG AGG CTT CTG GGT GT-3′ and rev: 5′-CAG GAT CAT GGA CGG GGA TG-3′. These fragments were cloned into the pCR II Topo vector (Invitrogen, Karlsruhe, Germany) and their nucleotide sequences were verified by an automated sequencer. Plasmids were isolated using QIAprep Spin Miniprep Kit from Qiagen (Hilden, Germany). Complementary strands for sense and antisense riboprobes were transcribed from either Sp6 or T7 RNA polymerases and labeled using rNTP mix containing digoxigenin labeled uridine triphosphates. All restriction enzymes, RNA polymerases and digoxigenin-labeled rNTP were purchased from Roche Diagnostics (Mannheim, Germany).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!