RNA was isolated using Trizol reagent following the manufacturer's instructions, followed by DNase1 digestion (NEB, M0303L). Reverse transcription of RNA was performed with High-Capacity cDNA RT Kit with random primers (Invitrogen, 4368814). The first-strand cDNA was diluted 1:5 in nuclease-free water and used as a template. Real-time qPCR was performed with SYBR Green PCR Master Mix (Invitrogen, 4364346) and the gene-specific primers shown in the following table. The housekeeping gene, Beta-actin, was used as an endogenous control. The relative expression of RNAs was calculated using the comparative Ct method.
High capacity cdna rt kit with random primers
Manufactured by Thermo Fisher Scientific
The High-Capacity cDNA RT Kit with random primers is a laboratory tool designed for the synthesis of first-strand cDNA from RNA samples. It provides a convenient and efficient method for the reverse transcription of RNA to complementary DNA.
Automatically generated - may contain errors
Lab products found in correlation
2 protocols using high capacity cdna rt kit with random primers
1
RNA Extraction and Quantitative PCR Analysis
2
Splicing Analysis Using GFP Reporter
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Reporter plasmid pZW4 was a kind gift from Zefeng Wang’s lab at the Partner Institute for Computational Biology Chinese Academy of Sciences and Max Planck Society, Shanghai. In this reporter construct, the cDNA sequence of GFP was divided into 2 exons. Arranged between these two exons were the exons and introns being tested for alternative splicing such as exon skipping. Site-directed mutagenesis was carried out to induce A to G mutations at particular intronic sites. All constructs were sequenced to confirmed correct insert before transfection.
Total RNA was isolated and purified using TRIzol (Invitrogen) followed by DNase I treatment. The reverse transcription was carried out with High-Capacity cDNA RT Kit with random primers (Invitrogen, 4368814). The PCR primers used in this assay are GFP-F (AGTGCTTCAGCCGCTACCC) and GFP-R (GTTGTACTCCAGCTTGTGCC).
Total RNA was isolated and purified using TRIzol (Invitrogen) followed by DNase I treatment. The reverse transcription was carried out with High-Capacity cDNA RT Kit with random primers (Invitrogen, 4368814). The PCR primers used in this assay are GFP-F (AGTGCTTCAGCCGCTACCC) and GFP-R (GTTGTACTCCAGCTTGTGCC).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!