The sgRNA-23b and sgRNA-27b were designed using the Benchling program (Supplementary Figure S7 ) and inserted into pSpCas9(BB)-2A-Puro (Addgene 62988) as described previously [22 (link)]. HCT-Oxa-c cells (15 × 104 cells/well) were seeded in 24-well plates 24 h before transfection and constructs were transfected into HCT-Oxa-c cells using Lipofectamine LTX (Thermo Fisher Scientific) according to the manufacturer’s instructions. After 48 h of transfection, cells were incubated for 48–72 h with 2 µg/mL puromycin (Sigma). Then puromycin-resistant cells were isolated through serial dilutions, seeding one cell per well of 96-well plates. Cells were grown in an incubator for 1–2 weeks, when cultivated into 24-well plates. Some of the cells were collected into tubes and indels were detected as described previously using polyacrylamide gel electrophoresis [23 (link)]. PCR was carried out with the Phire Tissue Direct PCR master Mix (Thermo Fisher Scientific). The list of primers and single-guide RNA (sgRNA) sequences (Metabion) are provided in Supplementary Table S15 .
Phire tissue direct pcr master mix
Manufactured by Thermo Fisher Scientific
Sourced in United States
Phire Tissue Direct PCR Master Mix is a ready-to-use solution for amplifying DNA from various tissue samples without prior DNA extraction. It enables direct PCR from tissue samples, streamlining the PCR workflow.
Automatically generated - may contain errors
Lab products found in correlation
Qiaquick pcr purification kit, by Qiagen (3 mentions)
Neon transfection system, by Thermo Fisher Scientific (3 mentions)
Puromycin, by Merck Group (2 mentions)
Dnase 1, by Thermo Fisher Scientific (2 mentions)
Superscript 3, by Thermo Fisher Scientific (2 mentions)
α thioglycerol, by Merck Group (2 mentions)
Tryple select 10, by Thermo Fisher Scientific (2 mentions)
Grna cloning vector, by Addgene (2 mentions)
Penicillin streptomycin, by Thermo Fisher Scientific (2 mentions)
Pspcas9 bb 2a puro, by Addgene (1 mentions)
Lipofectamine ltx, by Thermo Fisher Scientific (1 mentions)
Alt r crrna, by Integrated DNA Technologies (1 mentions)
Lipofectamine crisprmax reagent, by Thermo Fisher Scientific (1 mentions)
Penicillin, by Thermo Fisher Scientific (1 mentions)
Streptomycin, by Thermo Fisher Scientific (1 mentions)
Neurobasal a medium, by Thermo Fisher Scientific (1 mentions)
B27 supplement, by Thermo Fisher Scientific (1 mentions)
L glutamine, by Thermo Fisher Scientific (1 mentions)
Phusion polymerase, by Thermo Fisher Scientific (1 mentions)
Gotaq green master mix, by Promega (1 mentions)
37 protocols using phire tissue direct pcr master mix
1
CRISPR-Cas9 Knockout Protocol for HCT-Oxa-c Cells
2
MAFB Gene Editing using SpCas9
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
SpCas9 target sequence (5′-GGTGTGTCTTCTGTTCGGTC-3′) located in the first third of the unique MAFB coding exon was designed using a CRISPOR algorithm [29 (link)]. Alt-R®-crRNA corresponding to the MAFB target sequence and a human crRNA negative control were purchased from Integrated DNA Technologies IDT (Coralville, IA, USA). Alt-R® Hifi S.p. Cas9 Nuclease V3 (10 nM corresponding to 240 ng, IDT) was mixed with an equal molarity of each two-part gRNA (Alt-R®-crRNA + Alt-R®-tracrRNA) reconstituted following the supplier’s recommendations (IDT). Reverse transfection was performed on 40,000 Hep3B cells using Lipofectamine CRISPRMAX™ Reagent (Thermo Fisher Scientific, Bordeaux, France). At 2–3 days post transfection, a sample of cells was lysed and used as PCR template using Phire Tissue Direct PCR Master Mix (ThermoFisher Scientific). PCR amplification with subsequent Sanger sequencing of the targeted MAFB sequence was performed according the supplier’s recommendations with external specific primers (5′-CTCAGCACTCCGTGTAGCTC-3′ and 5′-ACGCTTGGTGATGATGGTGA-3′). Sanger data were used to quantify Indels reflecting gene knock-out (KO) with the TIDE and ICE (Inference of CRISPR Edits) algorithms [30 (link),31 ].
3
cDNA Preparation and Sequencing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To obtain cDNA, extracted RNA (MirVana) was treated with DNase I (Ambion) and then a reverse transcriptase reaction was performed with SuperScriptIII (Invitrogen), using 6-mer random primers. DNA was extracted using Phire Tissue Direct PCR Master Mix (Thermo Scientific). The amplification products were directly sequenced by Sanger sequencing.
4
Precise CRISPR-based Gene Editing Validation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Two clones were identified with perfect L allele knock-in by deep sequencing analysis. From these cell lysates a 1248 bp region were amplified centered by the MNLP position using Phire Tissue Direct PCR Master Mix (Thermo Fisher Scientific) and o483/o484 oligonucleotide combination (Supplementary Data 1 ). The correct size of the PCR product was analyzed on agarose gel and the rest of the PCR product was purified (QIAquick PCR Purification Kit, Qiagen) and then subjected for Sanger sequencing from both and using the o483 and o484 in two separate reactions. The presence of intact “tccg” and “gcgtc” “border sequences” (Supplementary Fig. S4b , indicated by gray lowercase letters, right next the MNLP alleles) furthermore correct upstream and downstream sequences were identified confirming the ideal allelic replacement without unwanted genomic alterations.
5
Primary Cortical Neuron Culture from αSyn-null Mice
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
C57BL/6LOlaHsd and C57BL/6JRccHsd mice, αSyn-null and wild-type respectively, were purchased from Envigo Srl. Mouse genotyping was performed with the Phire™ Tissue Direct PCR Master mix (F-170S, ThermoFisher) using primers previously described (mouse Snca exon 6: AAGACTATGAGCCTGAAGCCTAAG and AGTGTGAAGCCACAACAATATCC, 266 bp fragment; deletion junction, termed D6Slab17: TTGATAGTTCCACTGTTCTGGC and GTAACAATACAGCAAGAGATAC, 179 bp fragment)85 (link). Animals were maintained and experiments were conducted according to the Italian Ministry of Health and the approval by the Ethical Committee of the University of Padova (Protocol Permit #200/2019-PR). Cortical neurons were dissociated by papain from αSyn-null and wild-type mice postnatal day 0-1 (P0-1) pups as previously reported24 (link) and cultured in Neurobasal A medium (Life Technologies) supplemented with 2% v/v B27 Supplements (Life Technologies), 0.5 mM L-glutamine (Life Technologies), 100 U/mL penicillin, and 100 µg/mL streptomycin (Life Technologies) for 12 days prior to imaging and western blot analysis, refreshing half medium every 3 days. Treatments with 100 µM DOPAL were performed in complete medium for 24 h.
6
Genotyping of Transgenic Mosquito Lines
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genotyping was performed on genomic DNA extracted from single mosquitoes of aapp-DsRed, aapp-hGrx1-roGFP2, trio-DsRed, sag(-)KI, sag(-)EX and yellow(-)KI colonies. Genotyping PCRs were performed using GoTaq Green Mastermix (Promega) (S1B Fig S2 S7 FigsTable 1
7
Molecular Identification of Aphid Species for Transmission Experiments
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The following three aphid species were used in this work: the strawberry root aphid Aphis forbesi Weed, the melon aphid Aphis gossypii Glover and the strawberry aphid Chaetosiphon fragaefolii Cockerell. Isoclonal aphid cultures were started from the field-collected aphids. A single 1st instar nymph was isolated and transferred to a new F. vesca plant. This step was repeated three times. The colonies were maintained by transferring unwinged adult individuals to a new F. vesca plants every month.
Their taxonomic identification was performed using molecular barcoding (cox and cytb genes,Table S1 ) with published primers [37 (link),38 (link)] and Phire Tissue Direct PCR Master Mix following the manufacturer’s recommendations (Thermo Scientific, Waltham, MA, USA). The partial cox gene sequences were deposited at the NCBI repository under accession numbers OK181865.1, ON756037 and MN420510.1 for A. gossypii, A. forbesi and C. fragaefolii, respectively. The partial cytb gene sequences have accession numbers ON756035, ON756036, and ON756034 for A. gossypii, A. forbesi and C. fragaefolii, respectively.
For aphid-mediated transmission experiments, ten adult aphids were transferred to a CRM3 clonal plant and eight weeks later were used for the transmission and virus detection assays.
Their taxonomic identification was performed using molecular barcoding (cox and cytb genes,
For aphid-mediated transmission experiments, ten adult aphids were transferred to a CRM3 clonal plant and eight weeks later were used for the transmission and virus detection assays.
8
Establishing Stable HeLa Cell Lines
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
HeLa cells were transfected as indicated in Supplementary Table S24 . At 3 days post-transfection, the cells were transferred into wells of six-well plates (Greiner Bio-One) and were subsequently exposed to 1 μg ml−1 puromycin (Invitrogen, Cat. No.: A11138-03) for 7 days. The resulting puromycin-resistant HeLa clones were identified through colony-formation assays using standard Giemsa or Crystal violet staining protocols. In addition, parallel cultures of puromycin-resistant HeLa cell populations were seeded at a density of 0.3 cells per well in wells of 96-well plates (Greiner Bio-One). The resulting single cell-derived clones were then sub-cultured for ∼3 weeks in DMEM supplemented with 5% FBS, 1 μg ml−1 puromycin, 50 nM α-thioglycerol (Sigma-Aldrich; Cat. No.: M6145) and 0.02 nM bathocuproinedisulfonic acid disodium salt (Sigma-Aldrich; Cat. No.: B1125). Subsequently, genomic DNA of randomly collected single cell-derived clones was extracted and analysed by junction PCR using Phire™ Tissue Direct PCR Master Mix (Thermo Fisher Scientific, Cat. No.: F-107L) according to the manufacturer's protocols. The PCR primer pairs, composition of the PCR mixtures and cycling parameters are specified in Supplementary Tables S35 and S36 , respectively.
9
Efficient Cell Lysis and PCR Amplification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The goal of this step was to continue to allow the processing of the clones in an efficient manner without having to perform DNA extraction for each well.
Phire Tissue Direct PCR Master Mix (Thermo Scientific) was used according to our optimized protocol. Briefly, after media removal cells were detached by adding 20 μl TrypLE™ Select 10× (LifeTechnologies) for 10 minutes at room temperature. The reaction was quenched by 40μl 20% FBS containing RPMI-1640 media. Samples were mixed well and 30 μl of cell suspension transferred into a 384 well PCR plate. Cells were pelleted by centrifugation for 10 minutes at 3000g, and the supernatant removed. Cells were then suspended in 20 μl lysis buffer (950 μl lysis buffer + 50 μl DNA release solution) and denatured for 5 min at 99°C.
A premix sufficient for 192 reactions in 6 μl final volume and 500 nM final primer concentration per each was prepared allowing for a 1× reaction mix after added DNA template. Five μl premix was dispensed into each well and 1 μl cell lysate was added. The amplification was performed under the following thermal profile: ([98 °C, 2 min], [98 °C, 10 s; 65–60 °C, −0.5 °C/cycle, 10 s; 72 °C, 20 s]10 cycles, [98 °C, 10 s; 62 °C, −1 °C/cycle, 10 s; 72 °C, 20 s]25 cycles, [72 °C, 2 min]). PCR products were used for either T7E1 assay or sequencing.
Phire Tissue Direct PCR Master Mix (Thermo Scientific) was used according to our optimized protocol. Briefly, after media removal cells were detached by adding 20 μl TrypLE™ Select 10× (LifeTechnologies) for 10 minutes at room temperature. The reaction was quenched by 40μl 20% FBS containing RPMI-1640 media. Samples were mixed well and 30 μl of cell suspension transferred into a 384 well PCR plate. Cells were pelleted by centrifugation for 10 minutes at 3000g, and the supernatant removed. Cells were then suspended in 20 μl lysis buffer (950 μl lysis buffer + 50 μl DNA release solution) and denatured for 5 min at 99°C.
A premix sufficient for 192 reactions in 6 μl final volume and 500 nM final primer concentration per each was prepared allowing for a 1× reaction mix after added DNA template. Five μl premix was dispensed into each well and 1 μl cell lysate was added. The amplification was performed under the following thermal profile: ([98 °C, 2 min], [98 °C, 10 s; 65–60 °C, −0.5 °C/cycle, 10 s; 72 °C, 20 s]10 cycles, [98 °C, 10 s; 62 °C, −1 °C/cycle, 10 s; 72 °C, 20 s]25 cycles, [72 °C, 2 min]). PCR products were used for either T7E1 assay or sequencing.
10
Genotyping of Regenerated Clones
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
All regenerated clones were subjected for genotype screening by direct PCR method. Cells were detached by adding 20 µl of trypsin per each well and incubated for 2 min at 37 °C, then it was quenched by 40 µl media. Samples were mixed well and 30 µl of cell suspension transferred into 384 well PCR plates, and pelleted by centrifugation for 3 min at 3000 g, and the supernatant removed. Cells were then resuspended in 20 µl lysis buffer (950 µl lysis buffer + 50 µl DNA release solution) Phire Tissue Direct PCR Master Mix (Thermo Fisher Scientific) and denatured for 5 min at 99 °C. In all, 1 µl of cell lysate was directly used for PCR amplifications in 15 µl final volume, using o458 and o459 oligonucleotide combination. PCR products size were analyzed on agarose gel. L allele containing products were further analyzed by deep amplicon sequencing.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!