96 well reaction plate

For mtDNA quantification, total DNA was isolated from WT and CLUH-knockdown MDMs by using a DNeasy Blood and Tissues Kit (QIAGEN). Quantitative reverse-transcription PCRs were performed in triplicate in 96-well reaction plates (Applied Biosystems). Each reaction (final volume 10 μL) contained 25 ng DNA, 5 μL of Power SYBR-Green PCR Master Mix (Applied Biosystems), and 0.5 μM of each forward and reverse primer. Mitochondrial and nuclear encoded gene was amplified. Primers used are listed in Supplemental Table 2.

For mtDNA quantification, total DNA was isolated from 20 to 30 mg of testis tissues by using a DNeasy Blood and tissues kit (QIAGEN). qPCRs were performed in triplicate in 96-well reaction plates (Applied Biosystems). Each reaction (final volume 10 µl) contained 25 ng DNA, 5 µl of Power SYBR-Green PCR Master Mix (Applied Biosystems), and 0.5 µM of each forward and reverse primer. COX1, mitochondrial encoded gene, was amplified and β2 microglobulin (β2 m), nuclear encoded gene, was used as a normalizing control. Fold changes in mtDNA amount were calculated with the ΔΔCt method. The employed primers sequences were Cox1-Mus-F: TTTTCAGGCTTCACCCTAGATGA, Cox1-Mus-R: CCTACGAATATGATGGCGAAGTG, B2m-Mus-F: ATGGGAAGCCGAACATACTG, B2M-Mus-R:CAGTCTCAGTGGGGGTGAAT.

Total RNA was extracted with TRIZOL reagent (Life Technologies) and reverse transcribed using MuLV Reverse Transcriptase reverse transcriptase with random hexamer primers (both from Life Technologies) according to the manufacturer's instructions. Real-time RT-PCR was performed in a Realplex² Mastercycler (Eppendorf, Hamburg, Germany) using 96-well reaction plates (Applied Biosystems, Cheshire, UK), TaqMan Universal PCR Master Mix (Applied Biosystems) and TaqMan primers/probes for human Atg4B (Hs00367088_m1), Atg5 (Hs00169468_m1), Atg7 (Hs00197348_m1), Atg12 (Hs00740818_m1), p62 (Hs00177654_m1) and β2-microglobulin (Hs00984230_m1) as a house-keeping gene (all from Applied Biosystems). The amplification conditions were 50°C for 2 min and 95°C for 10 min, followed by 40 cycles of 15 s at 95°C and 1 min at 60°C. All assays were performed in triplicates. Averaged cycle of threshold (Ct) values of β2-microglobulin triplicates were subtracted from Ct values of target genes to obtain ΔCt, and relative gene expression was determined as 2^−ΔCt. The results were presented relative to the control value, which was arbitrarily set to 1.

For mtDNA quantification, total DNA was isolated from fibroblasts by using a High Pure PCR Template Preparation Kit (Roche ref 11796828001). Q-PCRs were performed in triplicate in 96-well reaction plates (Applied Biosystems). Each reaction (final volume 10 µl) contained 25 ng DNA, 5 µl of Power SYBR-Green PCR Master Mix (Applied Biosystems) and 0.5 µM of each forward and reverse primer. COX1 and MT-ND4, mitochondrial encoded genes, were amplified and β2 microglobulin (β2 m) and GAPDH nuclear-encoded genes were used as a normalizing control. Primers were COX1: F-5′-TCCACTATGTCCTATCAATA-3′ and R-5′-GGTGTAGCCTGAGAATAG-3′; ND4: F-5′-CGCACTAATTTACACTCA-3′ and R-5′-GCTAGTCATATTAAGTTGTTG-3′; β2m: F-5′-CAGCTCTAACATGATAACC-3′ and R-5′-CCTGTAGGATTCTTCTTTC-3′. GAPDH: F-5′-CCCTGTCCAGTTAATTTC-3′ and R-5′-CACCCTTTAGGGAGAAAA-3′.