To detect the mRNA levels of ATF6 and C/EBP homologous protein (CHOP), the total RNA was isolated from N2a cells after 1 hour of OGD/R with 3‐30 µmol/L of Uro‐A and ischemic brain tissues after 12 hour of MCAO by using ice‐cold Trizol reagent (Sigma, T9424). Total RNA was reverse‐transcribed into cDNA using the Prime Script One‐Step reverse transcription‐polymerase chain reaction (RT‐PCR) Kit (Takara, RR037A). PCR amplifications were performed with Brilliant II SYBR green QPCR master mix (Takara, RR037A). The primer sequences were as follows: mouse CHOP (Fw: 5‐GTCCAGCTGGGAGCTGGAAG‐3; Rev: 5‐CTGGTCAGGCGCTCGATTTCC‐3), mouse ATF6 (Fw: 5‐AAGTATGGGTTCGGATAT‐3; Rev: 5‐CTCTGACACCACCTCGTC‐3), and mouse β‐actin (Fw: 5‐CTGTCCCTGTATGCCTCTG‐3; Rev: 5‐ATGTCACGCACGATTTCC‐3). Beta‐actin was used as the endogenous control. The relative expression value was calculated via the 2–ΔΔCt method.
Brilliant 2 sybr green qpcr master mix
Manufactured by Takara Bio
Brilliant II SYBR green QPCR master mix is a ready-to-use solution for quantitative PCR (qPCR) analysis. It contains SYBR green I dye, hot-start DNA polymerase, and optimized buffer components to enable efficient and specific amplification of DNA targets.
Automatically generated - may contain errors
Lab products found in correlation
2 protocols using brilliant 2 sybr green qpcr master mix
1
Quantifying ER Stress Markers in Ischemic Injury
2
Estrogen and Cannabinoid Regulation of Thyroid Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Nthy-ori3-1 cells were treated with 0.1, 1, 10, or 100 nM E2 and 10 nM E2 + 100 nM (R,R)-THC for 48 h. Total RNA was extracted with TRIzol Reagent (TaKaRa) according to the manufacturer’s instructions and quantified using UV spectrophotometry (Applied Biosystems). cDNAs were synthesized using 1 g total RNA in a 10 mL reaction mixture with Oligo-(dT) 18 primer and 2× Brilliant II SYBR Green QPCR Master Mix (TaKaRa) (5 (link)). qRT-PCR reactions were performed on a Cycle iQ system using 1 uM primers (Table 1 ). The mRNA levels were measured using the SYBR Premix Ex Taq™ system (TaKaRa). The reactions were performed for 30 s at 95°C, followed by 40 cycles of 95°C for 5 s and 60°C for 30 s. Product specificity was verified by melting curve analysis. NIS, ER-α, and ER-β mRNA levels were quantified and calculated using the relative quantitative method (2-ΔΔCt) and normalized to that of β-actin.
Primers for RT-PCR analyses.
| Genes | Forward | Reverse |
|---|---|---|
| NIS | CCTATCGCTATGGCCTCAAGT | CGTGGCTACAATGTACTGCAAA |
| TPO | CTGTCACGCTGGTTATGGC | GCTAGAGACACGAGACTCCTCA |
| TSHR | GGAATGGGGTGTTCGTCTCC | GCGTTGAATATCCTTGCAGGT |
| TG | AGACACCTCCTACCTCCCTCA | GCTAGAGACACGAGACTCCTCA |
| ER-α | GAGGAGGGAGAATGTTG | CTGAAGGGTCTGGTAGG |
| ER-β | AACACCTGGGCACCTTT | GAGCATCCCTCTTTGAA |
ER, estrogen receptor; NIS, sodium iodide transporter; TG, thyroglobulin; TPO, thyroperoxidase; TSHR, thyroid stimulating hormone receptor.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!