Anti pum2

Whole cell lysates were prepared in RIPA buffer supplemented with protease and phosphatase inhibitors. Proteins were resolved on 10–15% SDS-PAGE gels and electroblotted onto PVDF membrane. Membranes were blocked with 5% BSA or dried skimmed milk in TBS-T and incubated in primary antibodies in blocking buffer: anti-pRPA32-Ser³³ (A300-246A Bethyl Laboratories), anti-phospho-γH2AX-Ser¹³⁹ (Merck Millipore, 05–636), anti-pCHK1-Ser³⁴⁵ (Cell signalling #2348), anti-RNA polymerase II CTD repeat YSPTSPS (phospho-S5) (Abcam ab5401), anti-PUM2 (Bethyl Laboratories A300-202A), anti-RNASEH1 (SantaCruz Biotechnologies, H-4, sc-376,326), anti-β-actin (Abcam ab6276), anti-Vinculin (Merck Millipore, V9131), anti-GAPDH (Cell Signalling 14C10 #2118). Membranes were washed and incubated with HRP-conjugated secondary antibodies and blots developed with Luminata™ forte (Merck-Millipore) and imaged using iBright (Invitrogen).

Mouse brains were dissected and fixed overnight in Hartman’s fixative (Sigma) and processed for immunohistochemistry according to standard protocols [68 (link)]. Immunostaining for PUM2 was performed following citrate buffer antigen retrieval by incubation with anti-PUM2 (Bethyl Lab) primary antibody and detected using Biotin-Streptavidin HRP Detection Systems (ZSGB-BIO). For PUM2 and GLUR2 co-localization in the hippocampus, brains were fixed with 4% paraformaldehyde (PFA) and cryostat cross-sectioned at 40 um thickness. The sections containing the dorsal hippocampus were blocked for 20 min with 1% bovine serum albumin in PBS. Immunoreactivity was detected using a rabbit anti-PUM2 polyclonal antibody (Milipore, 1:200) and mouse- anti-GLUR2 monoclonal antibody. Visualization of the second marker was accomplished using species-specific secondary antibodies conjugated with cyamine dye (Cy3), fluorescein isothiocyanate (1:200, Jackson ImmunoResearch, West Grove, PA, USA), or Alexa 488 (1:100; Molecular Probes, Eugene, OR, USA) for confocal microscopy (Olympus Fluoview).

Hippocampi of wildtype or Pum2^–/– mice were extracted with PLB buffer (100 mM KCL, 5 mM MgCl2, 10 mM Hepes, pH 7.0, 0.5% Nonidet P-40, 1 mM Dithiothrectol (DTT), 100 units/ml RNase OUT (Invitrogen-cat# 10777-019), supplemented with RNAse inhibitors and protease inhibitors. The lysate was pre-cleared with 15 ug of rabbit Ig and 50 µl protein G/A sepharose, then the protein concentration was measured. Hippocampal lysates were immunoprecipitated using protein A Sepharose beads (Amersham Pharmacia Biotech) and pre-incubated with 30 ug of anti-PUM2 (Bethyl Lab). Protein A conjugated Sepharose beads without antibodies were used as negative controls. After immunoprecipitation the beads were extracted with acid phenol-CHCI₃ (Ambion) to isolate RNA, followed by qRT-PCR using oligo dT (Promega) and amplification using mouse Glur2 specific primers (Glur2 specific primers forward: 5′GCCGAGGCGAAACGAATGA3′ reverse:5′ CACTCTCGATGCCATATACGTTG3′ and mouse actin primers forward: 5′TGACCCAGATCATGTTTGAG3′ reverse:5′GAGTCCATCACAATGCCTG3′)