Log In Sign up
The largest database of trusted experimental protocols

Pgipz lentiviral vector

Manufactured by Thermo Fisher Scientific
Visit Supplier
Sourced in United States

The PGIPZ lentiviral vector is a tool used for gene expression and gene knockdown studies in cells. It is a self-inactivating lentiviral vector that can be used to stably integrate genes of interest or shRNA sequences into the genome of target cells.

Automatically generated - may contain errors

Lab products found in correlation

Pspax2, by Addgene (3 mentions) Human scrambled shrna, by Thermo Fisher Scientific (2 mentions) Fip200 shrna, by Thermo Fisher Scientific (2 mentions) Tsc1 shrna, by Thermo Fisher Scientific (2 mentions) Mouse scrambled shrna, by Merck Group (2 mentions) Lal shrna 1 and 2, by Merck Group (2 mentions) Puromycin, by Merck Group (2 mentions) Lipofectamine 2000, by Thermo Fisher Scientific (2 mentions) Virapower packaging mix, by Thermo Fisher Scientific (2 mentions) Puromycin, by Thermo Fisher Scientific (2 mentions) Pmd2 g, by Addgene (2 mentions) Poly 1 c, by Cytiva (2 mentions) Cpg 2216, by Merck Group (2 mentions) Pcdna flag mkdm4d, by Addgene (2 mentions) 5 carboxy 8hq, by Bio-Techne (2 mentions) Recombinant murine gm csf, by Thermo Fisher Scientific (2 mentions) Lipopolysaccharides (lps), by Merck Group (2 mentions) Camk2n1 human cdna clone, by OriGene (1 mentions) Rpmi 1640 medium, by Thermo Fisher Scientific (1 mentions) Rpmi media, by American Type Culture Collection (1 mentions)

Close spelling variants of this product

Lentiviral pGIPZ vectors PGIPZ-lentiviral shRNAmir vectors Lentiviral shRNA pGIPZ vectors; NS (RHS4348) PGIPZ lentiviral vector system PGIPz lentiviral expression vector PGIPZ vector Lentiviral vector PGIPZ

25 protocols using pgipz lentiviral vector

1

Prostate Cancer Cell Line Engineering and Manipulation

Check if the same lab product or an alternative is used in the 5 most similar protocols
Human prostate cancer LNCaP cells were obtained from ATCC and maintained in in RPMI 1640 medium (Invitrogen) supplemented with 10% FBS or 10% charcoal/dextran stripped FBS (cFBS). C4-2 was maintained in RPMI 1640 medium (Invitrogen) supplemented with 10% FBS. The CAMK2N1 human cDNA clone was purchased from OriGene Technologies and subcloned into the EcoRI/XhoI site of MSCV-IRES-GFP (Addgen) retroviral vector. pGIPZ lentiviral vector, pGIPZ-shCAMK2N1-1 (shCA-1, 5′-TCAATAACAACCCGCTTGC-3′), pGIPZ-shCAMK2N1-3 (shCA-3, 5′-TAGACACCAGGAGGTGCCT-3′) were purchased from Thermo Scientific. PSA-Luc MMTV-Luc, ARE4-Luc reporter genes were described [30 (link)]. AKT inhibitor VIII was purchased from Perkin Elmer (Waltham, MA). LNCaP infected with GIPZ-Vector, shCA-1, shCA-3. C4-2 infected with MSCV-IRES-GFP, MSCV-CAMK2N1-IRES-GFP, pGIPZ-Vector, shCA-1, shCA-3. GFP positive cells were selected by FACS (Fluorescence Activated cell sorter).
Wang T., Guo S., Liu Z., Wu L., Li M., Yang J., Chen R., Liu X., Xu H., Cai S., Chen H., Li W., Xu S., Wang L., Hu Z., Zhuang Q., Wang L., Wu K., Liu J., Ye Z., Ji J.Y., Wang C, & Chen K. (2014). CAMK2N1 inhibits prostate cancer progression through androgen receptor-dependent signaling. Oncotarget, 5(21), 10293-10306.
+ Open protocol
+ Expand
2

Culturing and Modifying Human ES Cell Lines

Check if the same lab product or an alternative is used in the 5 most similar protocols
Human ES cell lines, SK-ES1 and TC71, were obtained and cultured as previously reported [19 (link)]. For primary culture, tissue samples from SK-ES1 primary tumors and metastases were transferred into a 10 cm cell culture plate, cut into pieces and cultured in RPMI media (ATCC, Manassas, VA) supplemented with 10% FBS. After a few days, cellular outgrowth from the tissue pieces was observed. Once cells reached confluence, they were trypsinized and propagated according to standard cell culture techniques. SK-ES1 cells stably expressing NPY shRNA (SK-ES1/NPY shRNA) or non-silencing shRNA (SK-ES1/NS shRNA) were created by transduction of SK-ES1 cells with a pGIPZ lentiviral vector (Thermo Scientific, Waltham, MA) encoding the corresponding shRNAs followed by puromycin selection.
Hong S.H., Tilan J.U., Galli S., Izycka-Swieszewska E., Polk T., Horton M., Mahajan A., Christian D., Jenkins S., Acree R., Connors K., Ledo P., Lu C., Lee Y.C., Rodriguez O., Toretsky J.A., Albanese C, & Kitlinska J. (2015). High neuropeptide Y release associates with Ewing sarcoma bone dissemination - in vivo model of site-specific metastases. Oncotarget, 6(9), 7151-7165.
+ Open protocol
+ Expand
3

Silencing FAF1 Gene Expression

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
For silencing of FAF1 gene expression, the pGIPZ lentiviral vector, which contains FAF1-specific shRNA sequences was purchased from Open Biosystems. (http://www.openbiosystems.com). Lentiviruses were produced as previously described [27 (link)]. In brief, HEK293T cells were transiently transfected with packaging plasmids (psPAX2 and pMD2.VSV-G) and pGIPZ containing non-specific shRNA or FAF1-specific shRNA sequences using Lipofectamine 2000. At 48–72 hr post-transfection, virus-containing media was collected and filtrated (0.45 μm filter, Millipore).
Kim T.H., Lee H.C., Kim J.H., Hewawaduge C.Y., Chathuranga K., Chathuranga W.A., Ekanayaka P., Wijerathne H.M., Kim C.J., Kim E, & Lee J.S. (2019). Fas-associated factor 1 mediates NADPH oxidase-induced reactive oxygen species production and proinflammatory responses in macrophages against Listeria infection. PLoS Pathogens, 15(8), e1008004.
+ Open protocol
+ Expand
4

Targeted Knockdown and Overexpression of PDCD4, AKT1-3

Check if the same lab product or an alternative is used in the 5 most similar protocols
Specific shRNA sequences targeting PDCD4, AKT1, AKT2, or AKT3 were inserted into the pGIPZ lentiviral vector (Open Biosystems). The target sequences were as follows: shPDCD4-1: CACCAATCATACAGGAATA, shPDCD4-2: GCTTCTTTCT GACCTTTGT, shAKT1-1: CCATAGTTGCGGGCCCGGTCC, shAKT1-2: AGTGCCCTTGCCCAGCAGC, shAKT2-1: CCAAT GAAGGAGCCGTCGCTC, shAKT2-2: GGGTGGCAGGAGCT TCTTC, shAKT3-1: AGAAACGTGTGCGGTCC, and shAKT3-2: GCTTCTGTCCATTCTTCCC. The PDCD4 coding sequence was cloned into the pHR-SIN lentiviral vector under CMV promoter control for over-expression studies.
Pin G., Huanting L., Chengzhan Z., Xinjuan K., Yugong F., Wei L., Shifang L., Zhaojian L., Kun H., Weicheng Y., Yingying L., Yongming Q, & Yanan Y. (2020). Down-Regulation of PDCD4 Promotes Proliferation, Angiogenesis and Tumorigenesis in Glioma Cells. Frontiers in Cell and Developmental Biology, 8, 593685.
+ Open protocol
+ Expand
5

Lentiviral Vector Construction and Characterization

Check if the same lab product or an alternative is used in the 5 most similar protocols
Human ASCL1, POU3F2, and MYT1L cDNA were purchased from GeneCopoeia or Open Biosystems, and cloned into pLenti6.3-TO/V5 lentiviral vectors by using Gateway shuttle vector system (Invitrogen). Human synapsin (hSyn) promoter-GFP lentivirus vector was prepared by inserting hSyn-EGFP region from pAAV-hSyn1-EGFP vector (a gift from Dr. S. Kugler, Germany) into pGIPZ lentiviral vector (Open Biosystems). Human wild-type SCN1A full-length cDNA (a gift from Dr. A. George, Vanderbilt University) was cloned into a CSII-EF-MCS-IRES-Venus lentiviral vector (a gift from Dr. H. Miyoshi, Japan) to generate CSII-EF-SCN1A-IRES-Venus vector. A CaMKII promoter-driven GFP reporter construct (FCKGW) was a gift from Dr. P. Osten (Cold Spring Harbor Laboratory). 293FT cells were transfected with each pLenti6.3 or GFP lentiviral vector and a set of virus packaging vectors by using Lipofectamine 2000 (Invitrogen). Lentiviral supernatants were collected 72 h later, and concentrated with either ultracentrifugation or PEG 8000 precipitation. Virus titers (infectious units: IFU) were determined using a Lenti-X p24 Rapid-Titer kit (Clontech). Aliquots of viruses were kept frozen at -80°C until use.
Kano S.I., Yuan M., Cardarelli R.A., Maegawa G., Higurashi N., Gaval-Cruz M., Wilson A.M., Tristan C., Kondo M.A., Chen Y., Koga M., Obie C., Ishizuka K., Seshadri S., Srivastava R., Kato T.A., Horiuchi Y., Sedlak T.W., Lee Y., Rapoport J.L., Hirose S., Okano H., Valle D., O'Donnell P., Sawa A, & Kai M. (2015). Clinical utility of neuronal cells directly converted from fibroblasts of patients for neuropsychiatric disorders: studies of lysosomal storage diseases and channelopathy. Current molecular medicine, 15(2), 138-145.
+ Open protocol
+ Expand
6

Lentiviral shRNA Knockdown Protocol

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
Human scrambled shRNA, FIP200 shRNA, and Tsc1 shRNA encoded in pGIPZ lentiviral vector were purchased from Open Biosystems (Lafayette, CO). Mouse scrambled shRNA, LAL shRNA #1 and #2 were purchased from Sigma. Package vectors of pSPAX2 and pMD2.G were mixed with shRNA vectors and transfected in HK293 cells for virus production essentially as described before37 (link).
Wang C., Haas M.A., Yang F., Yeo S., Okamoto T., Chen S., Wen J., Sarma P., Plas D.R, & Guan J.L. (2019). Autophagic lipid metabolism sustains mTORC1 activity in TSC-deficient neural stem cells. Nature metabolism, 1(11), 1127-1140.
+ Open protocol
+ Expand
7

Stable Lentiviral miR-501 Overexpression

Check if the same lab product or an alternative is used in the 5 most similar protocols
The human pre-miR-501 sequence was amplified from normal human genomic DNA and cloned into the pGIPZ lentiviral vector (Open Biosystems) to generate a miR-501 expression vector. Retrovirus solution expressing miR-501 or negative control (NC) was packaged with pMD2G and psPAX2 in HEK293T cells. The solution was supplement with 8 μg/mL polybrene. EC cells (1 × 105) were plated without antibiotics in six-well plates 1 day before incubation for stable transfection. Then the medium was removed and 1 mL of retrovirus solution was added to each well to incubate for 24 h. Then fresh medium containing 2 μg/ml puromycin (Sigma-Aldrich) was added to each well for screening. Cell colonies transfected with lentiviral vector were obtained after 10–14 days of selection.
Sun X., Hou L., Qiu C, & Kong B. (2021). MiR-501 promotes tumor proliferation and metastasis by targeting HOXD10 in endometrial cancer. Cellular & Molecular Biology Letters, 26, 20.
+ Open protocol
+ Expand
8

Lentiviral FAF1-Specific shRNA Transduction

Check if the same lab product or an alternative is used in the 5 most similar protocols
Oligonucleotide sequences of FAF1-specific shRNA cloned into the pGIPZ lentiviral vector expressing GFP was purchased at Open Biosystems. (http://www.openbiosystems.com). Lentiviruses were produced using transient transfection of packaging plasmids (psPAX2 and pMD2.VSV-G purchased from Addgene) into HEK293T cells using Lipofectamine 2000. Media supernatant containing the virus particles were collected after 72 hr, filtered (0.45 μm filter, Millipore) and infected to the RAW264.7 cells with 8μg/ml polybrene (Sigma). Culture medium was replaced after the transduction process (after 12hr) with fresh puromycine-containing medium every 2 days until resistant colonies could identified. Similarly, control cells were prepared by infecting lentivirus which was produced with pGIPZ lentiviral vector expressing GFP.
Kim J.H., Park M.E., Nikapitiya C., Kim T.H., Uddin M.B., Lee H.C., Kim E., Ma J.Y., Jung J.U., Kim C.J, & Lee J.S. (2017). FAS-associated factor-1 positively regulates type I interferon response to RNA virus infection by targeting NLRX1. PLoS Pathogens, 13(5), e1006398.
+ Open protocol
+ Expand
9

Knockdown of Synaptotagmin Proteins

Check if the same lab product or an alternative is used in the 5 most similar protocols
2.5 × 106 cells/T25 were used for these experiments. siRNA duplexes (400 pmol used) against syn-1 and syn-2, respectively, were obtained from Sigma and Invitrogen. When shRNA technique was used, lentiviruses were produced by transfecting 293T cells with a mixture of p8.91, pMD.G and pGIPZ lentiviral vector (Open Biosystems) containing the appropriate shRNA sequence. All knockdowns were assessed by WB and probing for endogenous proteins.
Sette P., O’Connor S.K., Yerramilli V.S., Dussupt V., Nagashima K., Chutiraka K., Lingappa J., Scarlata S, & Bouamr F. (2016). HIV-1 Nucleocapsid mimics the membrane adaptor Syntenin to gain access to ESCRTs and promote virus budding. Cell host & microbe, 19(3), 336-348.
+ Open protocol
+ Expand
10

Modulation of ITIH4-AS1 and REST in CRC

Check if the same lab product or an alternative is used in the 5 most similar protocols
All five human CRC cell lines (HT-29, SW620, SW480, HCT116, and LoVo) and the human colonic epithelial cell line NCM460 were provided by American Type Culture Collection (ATCC; Manassas, VA, USA). Cells were all grown in RPMI 1640 (GE Healthcare, Chicago, IL, USA) containing 10% fetal bovine serum (FBS; GE Healthcare) at 37°C in a humidified incubator with 5% CO2. Short hairpin RNA (shRNA) targeting ITIH4-AS1 (shITIH4-AS1) or REST (shREST) and the negative control (shCtrl) were purchased from Sigma-Aldrich (USA) and then ligated into the pGIPZ lentiviral vector (Open Biosystems, Huntsville, AL, USA). In addition, pGIPZ vectors sub-cloned with full-length ITIH4-AS1 (pGIPZ/ITIH4-AS1) or REST cDNA (pGIPZ/REST) were respectively used to overexpress ITIH4-AS1 or REST, with the empty control (pGIPZ/control) serving as negative controls. Afterward, HEK293T cells were co-transfected with Lenti-Pac HIV Expression Packaging Mix and above lentiviral vectors by using Lipofectamine 2000 (Life Technologies, USA) according to the manufacturer’s guides. Subsequently, LoVo cells were transfected with lentivirus containing shITIH4-AS1 or shCtrl, whereas HT-29 cells were transfected with those containing pGIPZ/ITIH4-AS1 or pGIPZ/control. Finally, the stably transfected cells that were then applied in subsequent experiments were selected by puromycin (2 μg/mL) treatment for 2 weeks.
Liang C., Zhao T., Li H., He F., Zhao X., Zhang Y., Chu X., Hua C., Qu Y., Duan Y., Ming L, & Guo J. (2019). Long Non-coding RNA ITIH4-AS1 Accelerates the Proliferation and Metastasis of Colorectal Cancer by Activating JAK/STAT3 Signaling. Molecular Therapy. Nucleic Acids, 18, 183-193.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!