Stepone cycler

Manufactured by Thermo Fisher Scientific

Sourced in United States

The StepOne cycler is a real-time PCR instrument designed for efficient and reliable nucleic acid amplification and detection. It features a compact design, intuitive software, and high-performance optics to enable precise and consistent results across a wide range of applications.

Automatically generated - may contain errors

Lab products found in correlation

16 protocols using stepone cycler

Quantifying Chromatin-Bound Smad Proteins

Check if the same lab product or an alternative is used in the 5 most similar protocols

qPCR was performed using chromatin immunoprecipitation reactions with the anti-Smad3 and Smad4 and isotype control antibodies, along with the indicated primers and KAPA SYBR FAST qPCR Kit (Kapa Biosystems, Wilmington, MA) in a StepOne cycler (Applied Biosystems, Carlsbad, CA). The CT values from triplicate qPCR reactions were extracted from the StepOne cycler (Applied Biosystems, Carlsbad, CA) onto spreadsheets and were analyzed with the relative quantification method 2^–ΔΔCT. The abundance level of a given amplicon per sample/condition was determined relative to its input (non-enriched) chromatin abundance and was additionally corrected relative to isotype control antibody immunoprecipitation sample.

Xu H., Agalioti T., Zhao J., Steglich B., Wahib R., Vesely M.C., Bielecki P., Bailis W., Jackson R., Perez D., Izbicki J., Licona-Limón P., Kaartinen V., Geginat J., Esplugues E., Tolosa E., Huber S., Flavell R.A, & Gagliani N. (2020). The induction and function of the anti-inflammatory fate of TH17 cells. Nature Communications, 11, 3334.

+ Open protocol

+ Expand

Validating RNA-Seq Findings via qRT-PCR

Check if the same lab product or an alternative is used in the 5 most similar protocols

We used qRT-PCR to validate the altered expression between wildtype and foxe3 indel larvae from the RNA-Seq experiments. For these studies, we used the same RNA samples that were previously submitted for RNA-Seq analysis. 1 ng cDNA was amplified using Universal SybrGreen mastermix containing Rox (Roche) and gene specific primers (Tables S5 and S6) at final concentrations of 2.5 μM. Reactions were run on a StepOne cycler (Thermo FischerScientific) and analyzed with StepOne™ Software and ExpressionSuite software (Thermo Fisher Scientific) according to the ΔΔCt method. We used gapdh or eef1a1l1 as internal control genes as above. All experiments were performed on the three biological replicates from wildtype EKW (control) larvae or from the incrossed foxe3 indel larvae and each reaction was run in triplicate.

Krall M., Htun S., Anand D., Hart D., Lachke S, & Slavotinek A. (2018). A zebrafish model of foxe3 deficiency demonstrates lens and eye defects with dysregulation of key genes involved in cataract formation in humans. Human genetics, 137(4), 315-328.

+ Open protocol

+ Expand

RT-qPCR Analysis of Gene Expression in HepG2 and Huh7 Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

Cellular RNA of untreated HepG2 and Huh7 cells were extracted using GeneMATRIX Universal RNA Purification Kit (Roboklon GmbH) according to the manufacturers' protocols, followed by treatment with 1 U DNAse I (Gibco; Thermo Fisher Scientific, Inc.) per µg RNA for the elimination of possible DNA contaminations. Reverse transcription into cDNA and qPCR were performed using GoTaq^® 1-Step RT-qPCR System (Promega Corporation) on a QuantStudio 5 Real-Time PCR System (Thermo Fisher Scientific, Inc.). The mixture for each sample/primer mix had a final volume of 10 µl containing 20 ng RNA and 250 nM of each primer. Melt curve controls were run to ensure primer specificity. The parameters for reverse transcription were as follows: 37°C for 15 min, 95°C for 10 min. Primer sequences are listed in Table SI. The obtained cDNA was analysed by using GoTaq^® 1-Step RT-qPCR System (Promega Corporation) and qPCR was run on a StepOne-Cycler (Thermo Fisher Scientific, Inc.) for 40 cycles of amplification (initial denaturation for 5 min at 95°C; followed by denaturation at 95°C for 15 sec, annealing at 60°C for 20 sec, elongation at 72°C for 45 sec for 40 cycles). All samples were run in tripli-cate. The relative target gene expression was calculated using the 2^−ΔΔCq method using GAPDH, β-actin or 18S rRNA as an internal control (39 (link)).

Bär S.I., Dittmer A., Nitzsche B., Ter-Avetisyan G., Fähling M., Klefenz A., Kaps L., Biersack B., Schobert R, & Höpfner M. (2022). Chimeric HDAC and the cytoskeleton inhibitor broxbam as a novel therapeutic strategy for liver cancer. International Journal of Oncology, 60(6), 73.

+ Open protocol

+ Expand

Examining PTC124 Effects on bmp4 Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

We used qRT-PCR to examine the effect of PTC124 treatment on bmp4 expression. We obtained total RNA at 3 dpf (Zymo Research Quick-RNA Miniprep kit) from 0 μM (control), 0.25 μM, and 0.5 μM of PTC124 treated larvae from the experiments with dechorionation. The RNA was treated with DNase and cDNA was synthesized with the SuperScript III First-Strand Synthesis System (Invitrogen). 1 ng cDNA was amplified using Universal SybrGreen mastermix containing Rox (Roche) and gene specific primers at final concentrations of 2.5 μM. Reactions were run on a StepOne cycler (Thermo Fischer Scientific) and analyzed with StepOne Software and ExpressionSuite software (Thermo Fisher Scientific) according to the ΔΔCt method. We used eef1a1l1 as an internal control gene. All experiments were performed on three biological replicates from PTC124 treated larvae, and each reaction was run in triplicate. We also performed RT-PCR on cDNA samples obtained from wildtype, EKW larvae and homozygous, bmp4^st72/st72 larvae to determine if bmp4 was expressed at 6 hpf and 1 dpf using primers eef1a1l1_Lim_F: CCAACTTCAACGCTCAGGTCAeef1a1l1_Lim_R: CAAACTTGCAGGCGATGTGA to amplify a 105 basepair fragment and primers bmp4_qRT PCR_F: CGCCTCTGCGATTCGTTTTTA and bmp4_qRT PCR_R CCCCTGTTTGATCTGGGTCTG to amplify a 123 basepair fragment.

Krall M., Htun S, & Slavotinek A. (2019). Use of PTC124 for nonsense suppression therapy targeting BMP4 nonsense variants in vitro and the bmp4st72 allele in zebrafish. PLoS ONE, 14(4), e0212121.

+ Open protocol

+ Expand

Profiling IL-13 Expressing Innate Lymphoid Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA from in vitro cultures was isolated with RNeasy Mini Kit (QIAGEN) and rtPCR was performed using KAPA Probe Fast qPCR Master Mix 2x Kit (Kapa Biosystems) with TaqMan probes (Applied Biosystems) in a StepOne cycler (Applied Biosystems). The cycle threshold (CT) values from duplicate rtPCR reactions were extracted from the StepOne cycler to Excel and were analysed with the relative quantification ΔCT method. RNA from IL-13 fate-mapped and not fate-mapped ILCs were sorted from Il13^YetCre/+;R26R^Ai14RFP mice as CD45.2⁺CD90.2⁺RFP+lin⁻ or CD45.2⁺CD90.2⁺RFP−lin⁻, respectively. Cells were sorted directly into RLT Plus Lysis Buffer using a MoFlo XDP (Beckman Coulter). RNA extraction was done using the RNeasy Plus Micro Kit (Qiagen; 74034) according to the manufacturer’s instructions and reverse transcribed using the SuperScript Vilo Master Mix (Invitrogen; 11754). The resulting cDNA was used as template for rtPCR with Power SYBR Green reagent (Applied Biosystems; 4367689) using the primers as indicated in (Supplementary Table 2) on a StepOnePlus cycler. Samples were analysed by the ΔCT method using Rps17 for normalization using StepOne software (Applied Biosystems).

Bielecki P., Riesenfeld S.J., Hütter J.C., Triglia E.T., Kowalczyk M.S., Ricardo-Gonzalez R.R., Lian M., Vesely M.C., Kroehling L., Xu H., Slyper M., Muus C., Ludwig L.S., Christian E., Tao L., Kedaigle A.J., Steach H.R., York A.G., Skadow M.H., Yaghoubi P., Dionne D., Jarret A., McGee H.M., Porter C.B., Licona-Limón P., Bailis W., Jackson R., Gagliani N., Gasteiger G., Locksley R.M., Regev A, & Flavell R.A. (2021). Skin-resident innate lymphoid cells converge on a pathogenic effector state. Nature, 592(7852), 128-132.

+ Open protocol

+ Expand

Quantitative Real-Time PCR Analysis of Gene Expression in Lung Cancer

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA from human lung cancer cell lines and from tumours grown in NSG mice was isolated using the TRI-Reagent (Merck, Kenilworth, NJ, USA), according to the manufacturer’s instructions. For cDNA synthesis, 0.5 μg of purified RNA was reverse-transcribed using the PrimeScript™ RT reagent kit (RR037A, Takara Bio Europe, Inc., Saint-Germain-en-Laye, France). For real time PCR analy-sis, 1 μL of cDNAs at 1:8 dilution cDNAs were amplified using KAPA SYBR^® FAST qPCR Master Mix (Kapa Biosystems, Inc., Wilmington, MA, USA) in a total volume of 10 μL according to the manufacturer’s instructions, in a Step One cycler (Applied Biosystems-ThermoFisher Scientific). Specific forward and reverse primers used included: CD82 forward 5′-GCTCATTCGAGACTACAACAGC-3′ and reverse 5′-GTGACCTCAGGGCGATTCA-3′, ROS1 forward 5′-TGTCTGCTGAATGAACCCCAA-3′ and reverse 5′-TGCCAGATCCCTGTGAATGAAA-3′, and RPII forward 5′-TCAATGCTGGTTTTGGTGACG-3′ and reverse 5′-GCATGTTGGACTCGATGCAG-3′. The relative fold change in gene expression was calculated with the 2(-ΔΔCT) method us-ing RPII as reference control. Cycle threshold (Ct) values ≥35 were considered as being background.

Roupakia E., Chavdoula E., Karpathiou G., Vatsellas G., Chatzopoulos D., Mela A., Gillette J.M., Kriegsmann K., Kriegsmann M., Batistatou A., Goussia A., Marcu K.B., Karteris E., Klinakis A, & Kolettas E. (2021). Canonical NF-κB Promotes Lung Epithelial Cell Tumour Growth by Downregulating the Metastasis Suppressor CD82 and Enhancing Epithelial-to-Mesenchymal Cell Transition. Cancers, 13(17), 4302.

+ Open protocol

+ Expand

Quantifying Gene Expression in Pericytes

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Gene expression levels were detected with Taqman (Applied Biosystems) or SYBR green assays (Applied Biosystems) using indicated primers (Table S5) and normalized to GAPDH and Cyclophilin, respectively. Expression levels were determined using the StepOne cycler (Applied Biosystems). Published mouse pancreatic pericytes RNA sequencing (34 (link)) was deposited in ArrayExpress (https://www.ebi.ac.uk/arrayexpress/experiments/E-MTAB-5325/). Published islet genomic data (48 (link)) was accessed in http://www.gaultonlab.org/pages/Islet_expression_HPAP.html.

Burganova G., Schonblum A., Sakhneny L., Epshtein A., Wald T., Tzaig M, & Landsman L. (2023). Pericytes modulate islet immune cells and insulin secretion through Interleukin-33 production in mice. Frontiers in Endocrinology, 14, 1142988.

+ Open protocol

+ Expand

Quantification of SPAG6 and L1TD1 Expression

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was isolated from NHBECs and from 5 NSCLC cell lines and reverse transcribed using OmniScript Reverse Transcriptase Kit (Qiagen) [11 (link)]. Expression of SPAG6 was determined using Taqman Gene Expression Assays Hs00542625_m1 (SPAG6) and Hs03929097_g1 (GAPDH) in a StepOne cycler (Applied Biosystems) and expression of L1TD1 was determined using Qiagen’s QuantiTect® SYBR Green PCR Kit (primer sequences see Additional file 1: Table S3). The ΔΔCt method was used to calculate differences in gene expression [32 (link)].

Altenberger C., Heller G., Ziegler B., Tomasich E., Marhold M., Topakian T., Müllauer L., Heffeter P., Lang G., End-Pfützenreuter A., Döme B., Arns B.M., Klepetko W., Zielinski C.C, & Zöchbauer-Müller S. (2017). SPAG6 and L1TD1 are transcriptionally regulated by DNA methylation in non-small cell lung cancers. Molecular Cancer, 16, 1.

+ Open protocol

+ Expand

Quantitative RNA Expression Analysis in C. parapsilosis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was isolated from C. parapsilosis CLIB214 either by extraction with hot acid phenol (Collart and Oliviero 2001 ) or phenol-chloroform (Cross and Tinkelenberg 1991 (link)). RNA preparations were treated with RNase-free DNase I (New England Biolabs) and cDNA was synthesized using Maxima H Minus First Strand cDNA Synthesis Kit with oligo(dT) primers (Thermo Scientific) in a total volume of 20 μl. Quantitative real-time PCR (RT-qPCR) was performed on cDNA template using gene-specific primers (Table S1) and Luminaris Color HiGreen High ROX qPCR Master Mix (Thermo Scientific) in a StepOne cycler (Applied Biosystems). All reactions were carried out in technical duplicates, and normalized to EFB1 (translation elongation factor EF-1 beta) mRNA. Relative mRNA levels for all genes were determined in at least three independent experiments and calculated by the relative standard curve method according to the manufacturer’s instructions (Applied Biosystems). The significance of differences between the samples and the control (SD medium) was evaluated by Student’s t-test and was considered significant when P < 0.05.

Zeman I., Neboháčová M., Gérecová G., Katonová K., Jánošíková E., Jakúbková M., Centárová I., Dunčková I., Tomáška L., Pryszcz L.P., Gabaldón T, & Nosek J. (2016). Mitochondrial Carriers Link the Catabolism of Hydroxyaromatic Compounds to the Central Metabolism in Candida parapsilosis. G3: Genes|Genomes|Genetics, 6(12), 4047-4058.

+ Open protocol

+ Expand

Quantitative RT-PCR Analysis of Tissue RNA

Check if the same lab product or an alternative is used in the 5 most similar protocols

Cellular RNA was retrieved as above. For tissue RNA extracts, brain, lung, and liver (but not bone marrow) tissues were passed through 70‐μm strainers (BD Biosciences, San Jose, CA), single cell suspensions were counted with a hemocytometer, and 10⁷ cells were subjected to RNA extraction as above. qPCR was performed using first‐strand synthesis with specific primers (Appendix Table S5) and SYBR FAST qPCR Kit (Kapa Biosystems, Wilmington, MA) in a StepOne cycler (Applied Biosystems, Carlsbad, CA). C_t values from triplicate reactions were analyzed with the relative quantification method 2^−ΔCt (Pfaffl, 2001). The abundance of a given mRNA was determined relative to glucuronidase beta (Gusb, GUSB) or hypoxanthine guanine phosphoribosyl transferase (Hprt, HPRT) reference transcripts. mRNA levels are presented as either 2^−ΔCt = 2⁻⁽Ct^{of transcript of interest)‐(}Ct^{of control transcript)} or as percentages or fractions relative to control samples. All qPCR analyses of cell lines were done on triplicate samples (technical n = 3) obtained on at least three independent occasions from each cell line (biological n ≥ 3). All qPCR analyses of tissues were done on triplicate samples (technical n = 3) obtained from three different C57BL/6 mice (biological n = 3).

Giannou A.D., Marazioti A., Kanellakis N.I., Giopanou I., Lilis I., Zazara D.E., Ntaliarda G., Kati D., Armenis V., Giotopoulou G.A., Krontira A.C., Lianou M., Agalioti T., Vreka M., Papageorgopoulou M., Fouzas S., Kardamakis D., Psallidas I., Spella M, & Stathopoulos G.T. (2017). NRAS destines tumor cells to the lungs. EMBO Molecular Medicine, 9(5), 672-686.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!