Faststart universal sybr green 2x master mix

Total RNA from each cell line was harvested using RNAeasy Plus (Qiagen). 10 μg of total RNA was reverse-transcribed and cDNA synthesized using random hexamer priming (Transcriptor cDNA synthesis, Roche). FastStart Universal SYBR Green 2X Master Mix (Roche) was used to perform quantitative PCR for hCa_V3.3 (CACNA1I: 5′CAATGGACTGGATGCTGTTG/5′ATCCAGGGGTTGTGGTTG) and β-actin (ACTB: 5′CCAACCGCGAGAAGATGA/5′CCAGAGGCGTACAGGGATAG). CACNA1I mRNA in each cell line was analyzed by the relative quantitation of gene expression method and using ACTB that encodes β-actin as the reference control gene (ΔΔCt method)33 (link). Threshold amplification cycle (CT) values were obtained for target (CACNA1I) and internal control (ACTB) to calculate ∆CT (CT target–CT reference), and ΔΔCt calculated before and after induction of CACNA1I by doxycycline treatment. We carried out 3–4 technical replicates, from three independent cell culture and dox-induction step (biological triplicates). The biological variability in our RT-qPCR experiments stems primarily from different overall levels of mRNA induction across biological replicates.

The total RNA was extracted from the LNCaP and LNCaP-AKR1C3 cells with the RNAeasy™ Animal RNA Isolation Kit with Spin Column (Beyotime Biotechnology, Shanghai, China).
RNAs were reverse-transcribed into cDNAs using EasyScript Reverse Transcriptase (Transgen Biotech, Beijing, China). qRT-PCR was performed using FastStart Universal SYBR Green 2X Master Mix (Roche, Basel, Switzerland), and the primer sequences are listed in Table S4 in the Supplementary Materials.