Seven enterotoxigenic genes (hblA, hblC, hblD, nheA, nheB, nheC, and cytK-2) and one emetic toxin-producing gene (cesB) were detected by PCR using the primers listed in Supplementary Table S2 (Hansen and Hendriksen, 2001 (link); Ehling-Schulz et al., 2005 (link); Oltuszak-Walczak and Walczak, 2013 (link)). Genomic DNA was extracted using a HiPure Bacterial DNA extraction kit (Magen, Guangzhou, China) under the instruction of the manufacturer. Concentration and purity of the DNA were measured by Nanodrop 2000 spectrophotometer (Thermo Fisher Scientific, United States). The amplification reactions were performed using ExTaq Mix kit (Takara, China) in a Biometra TOne 96G thermal cycler (Analytik Jena, Jena, Germany). The PCR reaction mixture (25 μL) contained 50 ng of genomic DNA, 1.0 μM of each primer and 12.5 μL ExTaq Mix. Amplification was performed according to the instruction of the manufacturer (ExTaq Mix, Takara, China).
Hipure bacterial dna extraction kit
Manufactured by Magen Biotechnology Co
Sourced in China
The HiPure Bacterial DNA Extraction Kit is a laboratory tool designed to efficiently extract and purify bacterial DNA from various sample types. The kit utilizes a silica-based membrane technology to capture and concentrate bacterial DNA, providing a reliable and consistent method for DNA isolation.
Automatically generated - may contain errors
Lab products found in correlation
Nanodrop 2000, by Thermo Fisher Scientific (2 mentions)
Biometra tone 96g thermal cycler, by Analytik Jena (1 mentions)
Extaq mix, by Takara Bio (1 mentions)
Immobilon ny membrane, by Merck Group (1 mentions)
Detection starter kit 1, by Roche (1 mentions)
Sanger sequencing, by Sangon (1 mentions)
Nanodrop nd 100, by Thermo Fisher Scientific (1 mentions)
4 protocols using hipure bacterial dna extraction kit
1
PCR Detection of Bacillus Toxin Genes
2
Genetic Profiling of Xanthomonas oryzae
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genomic DNA of 50 Xoo strains was extracted using the HiPure Bacterial DNA Extraction Kit (Magen, Guangzhou, China). DNA samples (50 µl) were digested with BamHI for 4 h at 37℃. The resulting DNA fragments were separated in 1.3% agarose gels at 80 V for 22 h and transferred to Immobilon-Ny + membranes (Millipore, USA). A hybridization probe was made from a digoxigenin (DIG)-labeled 2892-bp fragment derived from an SphI-digest containing the repetitive sequence of pthXo1 (GenBank: AY495676). The Detection Starter Kit I (Roche, Switzerland) was used to visualize hybridizing fragments according to the manufacturer’s instructions. The TALE-free strain Xoo PH containing an introduced copy of pthXo1, pthXo2 or avrXa7 (Additional file 1 : Table S6) was used to locate the major tal genes involved in virulence.
3
Bacterial Identification via 16S rRNA Sequencing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Drug-resistant strains were selected for 16S rRNA gene sequencing based on proportions of samples. Genomic DNA was extracted using a HiPure Bacterial DNA extraction kit (Magen, Guangzhou, China) following the manufacturer’s suggestions. The universal bacterial primers 27 F (AGAGTTTGATCCTGGCTCAG) and 1492R (GGTTACCTTGTTACGACTT) were used in polymerase chain reactions (PCRs), followed by amplicon product sequencing using Sanger sequencing (Sangon Biotech, Guangzhou, China) to identify bacterial types [19 (link)].
4
Bacterial Strains for Xanthomonas Research
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The bacterial strains used in this study are listed in Table 1 . A set of seven X. translucens strains, i.e., four X. translucens pv. undulosa strains: XtKm12, XtKm15, XtLr8, and XtFa1 and three X. translucens pv. translucens strains: XtKm8, XtKm9, and XtKm34 were selected from a collection of 57 strains isolated from wheat and barley in Iran during 2008 to 2017 (Khojasteh et al., 2019 ). The criteria used for selection of the strains were their host range and pathovar status, MLSA-based genetic diversity and TALE repertories of the strains (Khojasteh et al., 2020 (link)). The bacterial strains were streaked onto nutrient agar (NA) medium or nutrient broth medium (NB: NA without agar) when required and incubated at 28°C. All the strains were stored at −80°C in nutrient broth (NB) medium amended with 50% sterile glycerol. The genomic DNA of the bacterial strains was extracted from a 24 h culture in NB medium using the Hipure bacterial DNA extraction kit (Magen, Guangzhou, Guangdong, China) as recommended by the manufacturer. The quality and quantity of the DNAs were spectrophotometrically evaluated and adjusted to 1500 ng/μL using the NanoDrop ND-100 (NanoDrop Technologies, Waltham, MA, United States) and then confirmed by 1.0% agarose gel electrophoresis.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!