Stat3 c 20

Manufactured by Santa Cruz Biotechnology

STAT3 (C-20) is an antibody used in research applications. It is targeted against the C-terminus of STAT3 protein, which is a transcription factor that plays a role in cellular processes such as growth and survival. The antibody can be used for techniques like Western blotting, immunoprecipitation, and immunohistochemistry to detect and study the STAT3 protein.

Automatically generated - may contain errors

Lab products found in correlation

P erk1 2, by Cell Signaling Technology (3 mentions) P stat3, by Cell Signaling Technology (3 mentions) β actin, by Merck Group (2 mentions) Jnk c 17, by Cell Signaling Technology (2 mentions) Ran c 20, by Santa Cruz Biotechnology (2 mentions) C ets 1 antibodies c 20, by Santa Cruz Biotechnology (2 mentions) H3k4me3 cs200580 and total h3 antibodies 04 928, by Merck Group (2 mentions) Set1 antibody a300 289a, by Fortis Life Sciences (2 mentions) Traf6 h 274, by Santa Cruz Biotechnology (2 mentions) C myc 9e10, by Santa Cruz Biotechnology (2 mentions) Erk1 2 k 23, by Santa Cruz Biotechnology (2 mentions) Il 6 blocking antibody, by R&D Systems (2 mentions) Anti ubiquitin, by Santa Cruz Biotechnology (2 mentions) P jnk, by Cell Signaling Technology (2 mentions) Pias3, by Cell Signaling Technology (1 mentions) Recombinant lif, by Merck Group (1 mentions) P stat3 y705, by Cell Signaling Technology (1 mentions) Socs3, by Abcam (1 mentions) Phorbol myristate acetate (pma), by LC Laboratories (1 mentions) Nf κb p65 c22b4, by Cell Signaling Technology (1 mentions)

Close spelling variants of this product

Anti-STAT3 C-20 Anti-STAT3 (c-20) sc-482 α-STAT3 (C-20; Total STAT3 (C-20: sc-482, STAT3

8 protocols using stat3 c 20

Immunoblotting and ChIP Assays for Cell Signaling Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

The following antibodies were used at the indicated dilutions for immunoblotting: pJNK (#9251, 1:1000), p-p38 (#9211, 1:1000), pERK1/2 (#9101, 1:1000) and pSTAT3 antibodies (#9131, 1:1000), obtained from Cell Signaling; JNK (C-17, 1:1000), p38 (H-147, 1:1000), ERK1/2 (K-23, 1:1000), TRAF6 (H-274, 1:1000), anti-ubiquitin (P4D1, 1:1000), RAN (C-20, 1:1000), STAT3 (C-20, 1:1000), c-Myc (9E10, 1:5,000) and tubulin antibodies (10D8, 1:2000), obtained from Santa Cruz Biotech; and anti-K63 ubiquitin (HWA4C4, 1:750) and anti-Ubc13 antibodies (#371100, 1:1000), obtained from Enzo and Invitrogen, respectively. TRAF6 antibody (H-274) was also used for immunoprecipitation (1 g/sample). For ChIPs, the following antibodies were used at 2 g/sample: STAT3 (C-20) and c-Ets-1 antibodies (C-20), obtained from Santa Cruz Biotech; H3K4me3 (CS200580) and total H3 antibodies (04-928), obtained from Millipore; and Set1 antibody (A300-289A) from Bethyl Laboratories. For flow cytometry, fluorescently labeled antibodies to CD11b (M1/70, FITC-labeled), F4/80 (BM8, PerCP Cy5.5-labeled), M-CSFR (AFS98, APC-labeled) and RANK (R12-31, PE-labeled) from eBioscience were used at a 1:100 dilution. Recombinant murine RANKL, IL-6, IL-10 and IL-6 blocking antibody were purchased from R&D Systems.

Zhang H., Hu H., Greeley N., Jin J., Matthews A.J., Ohashi E., Caetano M.S., Li H.S., Wu X., Mandal P.K., McMurray J.S., Moghaddam S.J., Sun S.C, & Watowich S.S. (2014). STAT3 restrains RANK- and TLR4-mediated signaling by suppressing expression of the E2 ubiquitin ligase Ubc13. Nature communications, 5, 5798.

+ Open protocol

+ Expand

Immunoblotting and ChIP Assays for Cell Signaling Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

+ Open protocol

+ Expand

Characterization of STAT3 Signaling

Check if the same lab product or an alternative is used in the 5 most similar protocols

Polyclonal antibodies against STAT3 C20 (Santa Cruz Biotechnology, Santa Cruz, CA), pSTAT3 (Y705) (Cell Signaling Technology, Inc., Beverly, MA) SOCS3 (Abcam,), PIAS3 (Cell signaling Technology, Inc, Beverly, MA) and β-actin (Sigma-Aldrich, St. Louis, IL), were employed in these experiments. Ret-P1 monoclonal antibody recognizes an epitope on the N-terminus of opsin of rod photoreceptors (Barnstable, 1980 (link); Hicks and Barnstable, 1987 (link)). Recombinant LIF was purchased from Millipore (Billerica, MA), IGF1 mouse recombinant from Sigma (St Louis, MO), PMA from LC Laboratories (Woburn, MA), PTEN inhibitor (bpV(phen) from Calbiochem (Darmstadt, Germany), Protein tyrosine phosphatase inhibitor (NSC87877) from Tocris bioscience (Bristol, United Kingdom).

Pinzon-Guzman C., Xing T., Zhang S.S, & Barnstable C.J. (2014). Regulation Of Rod Photoreceptor Differentiation By STAT3 Is Controlled By A Tyrosine Phosphatase. Journal of molecular neuroscience : MN, 55(1), 152-159.

+ Open protocol

+ Expand

Immunodetection of Signaling Proteins

Check if the same lab product or an alternative is used in the 5 most similar protocols

GSTM1(1H4F2) (IHC and western): Novus Biologicals, LLC. (NBP2-22186); STAT3(C-20): Santa Cruz Biotechnology, Inc. (sc-482); Phospho-STAT3 (pSer727) Cell Signaling Technology, Inc. (#9134); p38 MAPK: Cell Signaling Technology, Inc. (#9212); Phospho-p38 MAPK (Thr180/Tyr182): Cell Signaling Technology, Inc. (#9211); NF-κB p65 (C22B4): Cell Signaling Technology, Inc. (#4764); NF-kB phospho-p65 (Ser536)(93HI): Cell Signaling Technology, Inc. (#3033); β-Actin Antibody (C4): Santa Cruz Biotechnology, Inc. (sc-47778).

Huang Y.C., Lai J.C., Peng P.H., Wei K.C, & Wu K.J. (2021). Chromatin accessibility analysis identifies GSTM1 as a prognostic marker in human glioblastoma patients. Clinical Epigenetics, 13, 201.

+ Open protocol

+ Expand

Signaling Pathway Profiling of Myeloid-Derived Suppressor Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

Sorted M-MDSC or PMN-MDSC stimulated with or without particulate β-glucan (100 µg/ml) for indicated times were lysed in Triton X-100 lysis buffer in the presence of protease and phosphatase inhibitor. The whole cell extracts were subjected to SDS-PAGE and electro-transferred to PDVF membrane. The membranes were blocked and probed overnight at 4°C with the relevant primary and then incubated with the secondary Abs. The blots were developed with ECL Plus Western Blotting Detection Reagents (GE Healthcare). The primary Abs included: p-Erk1/2 (Thr202/Tyr204, Cell Signaling). Erk1/2 (MK1, Santa Cruz), p-Stat3 (Tyr705, Cell Signaling), p-AKT (Ser473, Cell Signaling), p-p38 (Thr180/Tyr182, Cell Signaling), p-Zap/Syk (Tyr319/Tyr352, Cell Signaling), STAT3 (C-20, Santa Cruz), p-SAPK/JNK (Thr183/Tyr185, Cell Signaling) and β-actin (Sigma-Aldrich).

Albeituni S.H., Ding C., Liu M., Hu X., Luo F., Kloecker G., Bousamra M I.I., Zhang H.G, & Yan J. (2016). Yeast-derived Particulate β-Glucan Treatment Subverts the Suppression of Myeloid-derived Suppressor Cells by Inducing PMN-MDSC Apoptosis and M-MDSC Differentiation to APC in Cancer. Journal of immunology (Baltimore, Md. : 1950), 196(5), 2167-2180.

+ Open protocol

+ Expand

Optimized Chromatin Immunoprecipitation Assay

Check if the same lab product or an alternative is used in the 5 most similar protocols

Chromatin Immunoprecipitation (ChIP) assays were carried out using the ChIP-IT™ Express Enzymatic kit (Active Motif, Carlsbad, CA) according to the manufacturer’s instructions. To improve the sensitivity of the ChIP assay, cells were treated with the cross-linking agent Ethylene glycolbis(succinimidylsuccinate) (EGS, 1mM) for 30 min at 22°C prior to cross-linking with 1% formaldehyde (10 min at 22°C) [21 (link)]. Chromatin was sheared to an average size of 200 bp by enzymatic digestion, and then immunoprecipitated with anti-pY701-STAT1(A-2, Santa Cruz) or STAT3 (C-20, Santa Cruz). The ChIP-PCR primers for each gene were designed to amplify a proximal promoter region that contains putative STAT3 binding sites. The promoter sequences of ISGs (1kb upstream of the transcription start site) were retrieved using UCSC Genome Browser (http://genome.ucsc.edu) and putative STAT3 binding sites were identified by TFSEARCH (http://www.cbrc.jp/research/db/TFSEARCH.html). The following forward and reverse primers were used for ChIP-PCR:

Cxcl11, TTCCTGAGTTGGTGGGACTC; AAGCCACTGGAAGGTGAAAG; Gadd45γ, TCGCACAATGACTCTGGAAG; CCCACCCTGCAAACTTCTATC; Myd88, CTTTTAGGCTGGGTAGTTCTGG; TCGCCTGTGGAGTTTCCTAC; Oas1γ, TCGATGGGATCCTCAGAAAG; CCTGGCTGAAATGGGAAGTAG; Osmr, ACCAGGAGCAAATTCCTGTG; AATCAACTACGGGGCAAGTG; T2bp, ATTTCCATCCCAACCTCCTT; CAGAAGCCTCCTCACCTGTC; Tnfsf10, CATTGTTGCCTTCAGCAGTC; TCCTGGACAAAGGACAAAGG.

Pfeffer S.R., Fan M., Du Z., Yang C.H, & Pfeffer L.M. (2017). Unphosphorylated STAT3 regulates the antiproliferative, antiviral, and gene-inducing actions of Type I interferons. Biochemical and biophysical research communications, 490(3), 739-745.

+ Open protocol

+ Expand

STAT3 ChIP Assay for MLST8 Regulation

Check if the same lab product or an alternative is used in the 5 most similar protocols

ChIP assays were performed using an EZ‐ChIP™ kit, according to the manufacturer's instructions (EMD Millipore, Darmstadt, Germany). Briefly, cells were treated with 1% formaldehyde for 10 min at room temperature and the reaction was quenched for 5 min in 1× glycine. The cells were washed with PBS, scraped, pelleted, and resuspended in SDS lysis buffer for sonication. The DNA was sheared with 10 rounds of 10‐s pulses followed by 1 min of rest on wet ice using a sonicator (Branson Digital Sonifier 450, Danbury, CT, USA) equipped with a 2‐mm tip and set to 30% of maximum power. Sonicated cell lysates were precipitated with 2 μg of STAT3 (C‐20) or normal rabbit IgG (Santa Cruz Biotechnology). The precipitated protein–DNA complexes were subjected to proteinase treatment, and the amount of DNA was determined by quantitative PCR. The primer sequences to confirm the binding of STAT3 to the promoter region of MLST8 gene were 5′‐tgggctcagtgggatgtcct‐3′ (sense) and 5′‐aagctgcggctttctctcc‐3′ (antisense).

Lee H., Chin H., Kim H., Jung H, & Lee D. (2020). STAT3‐mediated MLST8 gene expression regulates cap‐dependent translation in cancer cells. Molecular Oncology, 14(8), 1850-1867.

+ Open protocol

+ Expand

Signaling Pathway Protein Detection

Check if the same lab product or an alternative is used in the 5 most similar protocols

All chemicals were obtained from Sigma-Aldrich unless otherwise stated. TBK1 (3013), phosphorylated TBK1 (Serl72-5483) diluted 1:500, Stat3 (9139), phosphorylated Stat3 (Tyr705-9131), p38 (9212), phosphorylated p38 (Thrl80/Tyrl82-9211), tubulin (2128)-specific antibodies were purchased from Cell Signaling. HDAC1 (H-51) and Stat3 (C-20)-specific antibodies were purchased from Santa Cruz. RalA (610222)-specific antibody was obtained from BD Bioscience and used at a dilution of 1:3,000. IL-6 antibody was obtained from Abcam (ab6672). All antibodies were diluted 1:1,000 unless otherwise noted. EDTA-free protease inhibitor tablet was purchased from Roche Diagnostics. For in vitro experiments InSolution SB203,580 (1 mg ml⁻¹) was purchased from Calbiochem-EMD. For in vivo experiments SB203,580 powder was purchased from Selleck Chemicals.

Reilly S.M., Ahmadian M., Zamarron B.F., Chang L., Uhm M., Poirier B., Peng X., Krause D.M., Korytnaya E., Neidert A., Liddle C., Yu R.T., Lumeng C.N., Oral E.A., Downes M., Evans R.M, & Saltiel A.R. (2015). A subcutaneous adipose tissue–liver signalling axis controls hepatic gluconeogenesis. Nature Communications, 6, 6047.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!