Oligotex direct mrna mini kit

Manufactured by Qiagen

Sourced in Germany

The Oligotex Direct mRNA Mini Kit is a laboratory equipment product designed for the direct isolation of mRNA from small sample sizes. It provides a simple and efficient method for extracting mRNA from various biological samples.

Automatically generated - may contain errors

Lab products found in correlation

Hiseq 2000 system, by Illumina (2 mentions) Hybond n membrane, by GE Healthcare (1 mentions) Eco real time pcr system, by Illumina (1 mentions) Superscript 3, by Thermo Fisher Scientific (1 mentions) Sybr green pcr master mix, by Thermo Fisher Scientific (1 mentions) Rneasy miniprep kit, by Qiagen (1 mentions) Gel purification kit, by Qiagen (1 mentions) Smarter pcr cdna synthesis kit, by Takara Bio (1 mentions) Pcr purification kit, by Qiagen (1 mentions) Smarter race cdna amplification kit, by Takara Bio (1 mentions) Pmd18 t vector, by Takara Bio (1 mentions) Rneasy mini kit, by Qiagen (1 mentions) Magna pure lc, by Roche (1 mentions) Rneasy mini spin column, by Qiagen (1 mentions) Pgem t easy vector system 1, by Promega (1 mentions) Trizol, by Thermo Fisher Scientific (1 mentions) Ultrahyb, by Thermo Fisher Scientific (1 mentions) Brightstar plus, by Thermo Fisher Scientific (1 mentions) Trisure, by Meridian Bioscience (1 mentions) Qiaquick pcr purification kit, by Qiagen (1 mentions)

17 protocols using oligotex direct mrna mini kit

Quantitative Analysis of mRNA m6A Methylation

Check if the same lab product or an alternative is used in the 5 most similar protocols

The mRNA m⁶A was quantitatively evaluated by the m⁶A dot‐blot assay and the colorimetrically quantified by m⁶A RNA methylation assay. For RNA m⁶A dot‐blot assay, intact mRNA was purified from total RNA by using the Oligotex Direct mRNA Mini Kit (QIAGEN, 72022). The concentration of purified mRNA was spectrophotometrically determined by using NanoDrop, and serial dilution of mRNA to 250 and 50 ng/μL was performed with RNAase‐free water. Then, the purified mRNA was denatured at 95°C for 15 min, followed by chilling on ice. Two microlitres of denatured RNA samples was applied to Hybond‐N+ membrane (GE, RPN303B). After UV cross‐linking on Stratalinker 2400, the membrane was washed in 1× Phosphate Buffered Saline with Tween 20 buffer, blocked in 5% skim milk and later incubated with anti‐m⁶A antibody overnight at 4°C. Afterwards, the membrane was washed with 1× TPST buffer and sequentially incubated with goat anti‐rabbit IgG‐Horseradish peroxidase (IgG‐HRP) antibody and Enhanced Chemiluminescence (ECL) solution for chemiluminescence reading on a Chemi system (Bio‐Rad). Meanwhile, membrane was stained with .02% methylene blue, serving as a reference. For colorimetric quantification of m⁶A RNA methylation, the RNA m⁶A level was detected by using the EpiQuikTM m⁶A RNA Methylation Kit (Epigentek, P‐9005‐96) following the manufacturer's protocol.

Yu Y., Deng H., Wang W., Xiao S., Zheng R., Lv L., Wang H., Chen J, & Zhang B. (2024). LRPPRC promotes glycolysis by stabilising LDHA mRNA and its knockdown plus glutamine inhibitor induces synthetic lethality via m6A modification in triple‐negative breast cancer. Clinical and Translational Medicine, 14(2), e1583.

+ Open protocol

+ Expand

Extracting mRNA from Oocytes

Check if the same lab product or an alternative is used in the 5 most similar protocols

mRNA was extracted from approximately 25 oocytes of each experimental group using Oligotex direct mRNA minikit (Qiagen, 72022). RNA quality and quantity was assessed by NanoDrop spectrophotometer.

Dutta D.J., Raj H, & Dev A.H. (2016). Polyadenylated tail length variation pattern in ultra-rapid vitrified bovine oocytes. Veterinary World, 9(10), 1070-1074.

+ Open protocol

+ Expand

mRNA Isolation and Sequencing

Check if the same lab product or an alternative is used in the 5 most similar protocols

mRNA was isolated from two mice using an Oligotex Direct mRNA Mini Kit (Qiagen). Library preparation was performed according to the Illumina Single-End sequencing guide and sequenced using an Illumina Hi-Seq 2000 system. Total RNA was extracted with an RNeasy miniprep kit (Qiagen) according to the manufacturer’s instructions and reverse transcribed with SuperScriptIII (Invitrogen). cDNA was used for qPCR with specific primers and SYBR Green PCR Master Mix (Applied Biosystems) using an Illumina Eco Real-Time PCR System. A full list of primers can be found in Additional file 2: Table S5.

Proserpio V., Piccolo A., Haim-Vilmovsky L., Kar G., Lönnberg T., Svensson V., Pramanik J., Natarajan K.N., Zhai W., Zhang X., Donati G., Kayikci M., Kotar J., McKenzie A.N., Montandon R., Billker O., Woodhouse S., Cicuta P., Nicodemi M, & Teichmann S.A. (2016). Single-cell analysis of CD4+ T-cell differentiation reveals three major cell states and progressive acceleration of proliferation. Genome Biology, 17, 103.

+ Open protocol

+ Expand

mRNA Extraction and qPCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Cells were immersed in GITS and used for mRNA extraction with the Oligotex Direct mRNA Mini Kit (Qiagen) [18 (link)]. The quantitative mRNA PCR was performed as previously described [18 (link)].

Forslund O., Sugiyama N., Wu C., Ravi N., Jin Y., Swoboda S., Andersson F., Bzhalava D., Hultin E., Paulsson K., Dillner J., Schwartz S., Wennerberg J, & Ekblad L. (2019). A novel human in vitro papillomavirus type 16 positive tonsil cancer cell line with high sensitivity to radiation and cisplatin. BMC Cancer, 19, 265.

+ Open protocol

+ Expand

Profiling TCR Repertoire in EAE

Check if the same lab product or an alternative is used in the 5 most similar protocols

Foxp3-GFP reporter mice were immunized with MOG_35–55 to induce EAE as described above. CNS tissue was harvested 17 days post injection, pooled from 9 mice, and CD4⁺Foxp3⁺ and CD4⁺Foxp3⁻ TRBV13-2⁺ populations were isolated by flow cytometric sorting. 5′ RACE amplification of TCR alpha chains was performed as previously reported (24 ). Briefly mRNA was extracted using Oligotex Direct mRNA mini kit (QIAgen) and used as a template for cDNA amplification with the SMARTer PCR cDNA synthesis kit (Clontech). Amplified cDNA was cleaned using the PCR purification kit (QIAgen) and rearranged TCR products were amplified using a primer specific for the TCR alpha constant domain (5′ – TCAACTGGACCACAGCCTCAGCGTCA – 3′). Products were run on a 1% agarose gel and fragments between 500 and 700 bp were extracted using QIAgen gel purification kit. Extracted fragments were cloned into the PCR2.1-TOPO vector for miniprep and sequence analysis.

Zhao Y., Nguyen P., Ma J., Wu T., Jones L.L., Pei D., Cheng C, & Geiger T.L. (2016). Preferential use of public TCR during autoimmune encephalomyelitis. Journal of immunology (Baltimore, Md. : 1950), 196(12), 4905-4914.

+ Open protocol

+ Expand

Determination of Primary MIR944 Transcripts

Check if the same lab product or an alternative is used in the 5 most similar protocols

Poly A+ RNAs from human primary keratinocytes were extracted using the Oligotex Direct mRNA Mini kit (Qiagen, Valencia, CA, USA) as per the manufacturer's protocol. Next, the 5′-end of primary MIR944 transcripts was determined by 5′RACE using a SMARTer RACE cDNA Amplification kit (Clontech, Mountain View, CA, USA), followed by a nested PCR reaction. The first-stage of PCR utilized Universal Primer mix (forward primer) and a primary MIR944 transcript-specific primer (reverse primer: 5′-GGGCCTTTATTTGTCTTCCCTGCCA-3′). The second-stage PCR was performed with the Nested Universal Primer A (forward primer) and another primary MIR944 transcript-specific primer (reverse primer: 5′-GAGAGGCTGCAGGGAAGAGCAATCT-3′). The nested RACE products were separated on an agarose gel, extracted, cloned into the pMD18-T vector (Takara Bio Inc., Otsu, Japan), and sequenced.

Kim K.H., Cho E.G., Yu S.J., Kang H., Kim Y.J., Kim S.H, & Lee T.R. (2015). ΔNp63 intronic miR-944 is implicated in the ΔNp63-mediated induction of epidermal differentiation. Nucleic Acids Research, 43(15), 7462-7479.

+ Open protocol

+ Expand

Construction of T7-phage cDNA Libraries

Check if the same lab product or an alternative is used in the 5 most similar protocols

Two T7-phage cDNA libraries were constructed using tissues from AAH or SCD patients. Total RNA was extracted and purified by using the RNeasy Mini Kit (Qiagen). PolyA mRNA was isolated from total RNA by Oligotex Direct mRNA Mini Kit (Qiagen) and mRNA concentration was measured by mRNA Concentration Module (Invitrogen). Equal amounts of mRNA from either 3 AAH or 3 SCD tissue samples were pooled and reverse transcribed to cDNA with random primers, ligated with EcoRI/HindIII linkers, and cloned into T7 select 10-3b vector arms of phage using the T7Select system (Novagen) according to the manufacturers instructions. After in vitro packaging, a phage library was obtained, and the titer of the phage library was tested using a plaque assay to determine the number of recombinants (inserts) generated within the library.

Lowe F.J., Shen W., Zu J., Li J., Wang H., Zhang X, & Zhong L. (2014). A novel autoantibody test for the detection of pre-neoplastic lung lesions. Molecular Cancer, 13, 78.

+ Open protocol

+ Expand

Nucleic Acid Extraction from Samples

Check if the same lab product or an alternative is used in the 5 most similar protocols

Each sample was transferred to a 500 µL solution of 4 M guanidinium thiocyanate, 22 mM sodium citrate, 5% sarcosyl, and 1% mercaptoethanol (Sigma-Aldrich, St. Louis, MO, USA) and incubated at room temperature overnight. Extraction of nucleic acids was performed with a Total NA-kit using MagNA Pure LC (Roche, Basel, Switzerland), while mRNA extraction was performed using an Oligotex Direct mRNA Mini Kit (Qiagen, Hilden, Germany). The mRNA was eluted by adding 45 µL of Oligotex elution buffer (70 °C) to the column, followed by 1 min centrifugation at max speed. Purified DNA and RNA were stored at −20 °C and −80 °C, respectively.

Jimenez D.G., Sobti A., Askmyr D., Sakellariou C., Santos S.C., Swoboda S., Forslund O., Greiff L, & Lindstedt M. (2021). Tonsillar Cancer with High CD8+ T-Cell Infiltration Features Increased Levels of Dendritic Cells and Transcriptional Regulation Associated with an Inflamed Tumor Microenvironment. Cancers, 13(21), 5341.

+ Open protocol

+ Expand

Subtractive Hybridization of Tester-Specific Genes

Check if the same lab product or an alternative is used in the 5 most similar protocols

The sorted viable CD34⁺ CD45⁺ cells from aforementioned SAM expression analysis were used for total RNA extraction was performed by lysing the cells in Trizol (Ambion, Naugatuck, CT, US). Following addition of chloroform to the lysate, the aqueous phase was mixed with 70% ethanol and transferred to RNeasy Mini spin columns (Qiagen, Hilden, Germany). Total RNA preparation was completed according to the manufacturer’s protocol. Poly A⁺ RNA purification was performed using Oligotex Direct mRNA mini kit (Qiagen) following the manufacturer’s instructions. Subtractive hybridization was carried out using the Clontech^® PCR-Select™ Differential Screening kit (Takara Bio USA, Inc., Mountain View, CA 94043, USA) according to the manufacturer’s protocol. The poly A⁺ RNA from PE and normotensive groups were respectively used as tester and driver for cDNA synthesis. Enriched tester-specific amplicons from the second round of subtraction were ligated into pGEM-T Easy Vector System I (Promega, Madison, WI, US) for insert sequencing (Beckman Coulter Genomics, Bishop’s Stortford, United Kingdom). All retrieved sequences representing genes unique to the tester (PE) population compared to the normotensive population were blasted using BLAST analysis on NCBI (https://blast.ncbi.nlm.nih.gov/Blast.cgi).

Masoumi Z., Maes G.E., Herten K., Cortés-Calabuig Á., Alattar A.G., Hanson E., Erlandsson L., Mezey E., Magnusson M., Vermeesch J.R., Familari M, & Hansson S.R. (2019). Preeclampsia is Associated with Sex-Specific Transcriptional and Proteomic Changes in Fetal Erythroid Cells. International Journal of Molecular Sciences, 20(8), 2038.

+ Open protocol

+ Expand

Zebrafish Transcriptome Analysis by Northern Blotting

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was purified from zebrafish tissues using TRIzol. For isolation of poly(A)⁺ RNA from total RNA, an Oligotex Direct mRNA mini kit (Qiagen) was used. 2 μg of each poly(A)⁺ RNA was separated on a 1.0% formaldehyde-agarose gel with 1× MOPS buffer. After soaking in 50 mm sodium hydroxide for 25 min and twice in 200 mm sodium acetate, pH 4.0, for 20 min, the gel was transferred to a nylon membrane (BrightStar-Plus; Ambion) with 20× SSPE. The membrane was UV cross-linked, dried at 80 °C for 2 h, and stored at −20 °C. After prehybridization with ULTRAhyb (Ambion) containing 1 mg/ml torula yeast total RNA (Sigma), the filter was probed with ³²P-labeled DrPOLN cDNA (DQ630550), DrHAUS3 cDNA (BC124280), or Drβ-ACTIN cDNA (BC063950) at 42 °C for 16 h, followed by washing twice with 2× SSPE + 1% SDS at room temperature for 15 min and twice with 1× SSPE + 0.1% SDS at 50 °C for 20 min. Blots were exposed to Kodak X-Omat XAR film.

Takata K.I., Tomida J., Reh S., Swanhart L.M., Takata M., Hukriede N.A, & Wood R.D. (2015). Conserved Overlapping Gene Arrangement, Restricted Expression, and Biochemical Activities of DNA Polymerase ν (POLN). The Journal of Biological Chemistry, 290(40), 24278-24293.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!