The device was fabricated using standard photolithographic methods. In brief, electrodes were patterned on a glass substrate. The device was passivated using SU-8 2002 (Microchem, Newton, MA) and apertures were patterned to expose the electrodes below. The channel was fabricated by patterning SU-8 3050 (Microchem, Newton, MA).
Su 8 2002
Manufactured by MicroChem
Sourced in United States
SU-8 2002 is a negative photoresist material used in microfabrication processes. It is a polymer that undergoes cross-linking when exposed to ultraviolet (UV) light, making the exposed areas insoluble in the developer solution. The SU-8 2002 formulation is designed to provide a film thickness range of 1-5 micrometers.
Automatically generated - may contain errors
Lab products found in correlation
Sylgard 184, by Dow (3 mentions)
Su 8 2050, by MicroChem (2 mentions)
Su 8 3050, by MicroChem (1 mentions)
Tris buffer, by Thermo Fisher Scientific (1 mentions)
Tris 2 carboxyethyl phosphine hydrochloride tcep, by Merck Group (1 mentions)
Sodium chloride (nacl), by Merck Group (1 mentions)
Polydimethylsiloxane, by Thermo Fisher Scientific (1 mentions)
Diacetone alcohol daa, by Nacalai Tesque (1 mentions)
Potassium hydroxide, by Merck Group (1 mentions)
Hydrogen peroxide, by Merck Group (1 mentions)
Potassium chloride (kcl), by Merck Group (1 mentions)
6 mercapto 1 hexanol, by Merck Group (1 mentions)
1510 ultrasonic cleaner, by Emerson (1 mentions)
Anisole, by Merck Group (1 mentions)
Dimethyl sulfoxide (dmso), by Merck Group (1 mentions)
Su 8 2005, by MicroChem (1 mentions)
Su 8 2010, by MicroChem (1 mentions)
Sylguard 184, by Dow (1 mentions)
Sylgard, by Dow (1 mentions)
Pdc 32g, by Harrick (1 mentions)
24 protocols using su 8 2002
1
Photolithographic Microfabrication of Electrodes
2
Thiol-Modified DNA Probe Preparation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
6-Mercapto-1-hexanol (MCH) (HS(CH2)6OH, 97%), Tris(2-carboxyethyl)phosphine hydrochloride
(TCEP), and sodium chloride (NaCl, 99.9%) were obtained from Sigma-Aldrich
(Germany). The 10 mM Tris–EDTA solution [TE, 10 mM Tris, 1
mM ethylenediaminetetraacetic acid (EDTA), pH 8] and Tris buffer (10
mM Tris–HCl, pH 7.5) were obtained from ThermoFisher Scientific
(Sweden). Ethanol (99.5%) was supplied by VWR (Sweden) whereas SU-8
2002 was obtained from MicroChem (USA). All chemicals, which were
of analytical grade or better, were used as received. All aqueous
solutions were prepared with ultrapure water with a resistivity higher
than 18 MΩ·cm.
The oligonucleotides, which were purchased
from Integrated DNA Technologies (Canada), had the following sequences:
5′-HO-(CH2)6–S–S–(CH2)6GCATTGGTCTACAAGTGAATCTCGA-3′
for the thiol-modified probe DNA and TCGAGATTCACTTGTAGACCAATGC
for the target DNA. The oligonucleotides were hydrated in 10 mM TE
buffer to yield a concentration of 100 μM, and aliquots were
kept at −20 °C for long-term storage.
(TCEP), and sodium chloride (NaCl, 99.9%) were obtained from Sigma-Aldrich
(Germany). The 10 mM Tris–EDTA solution [TE, 10 mM Tris, 1
mM ethylenediaminetetraacetic acid (EDTA), pH 8] and Tris buffer (10
mM Tris–HCl, pH 7.5) were obtained from ThermoFisher Scientific
(Sweden). Ethanol (99.5%) was supplied by VWR (Sweden) whereas SU-8
2002 was obtained from MicroChem (USA). All chemicals, which were
of analytical grade or better, were used as received. All aqueous
solutions were prepared with ultrapure water with a resistivity higher
than 18 MΩ·cm.
The oligonucleotides, which were purchased
from Integrated DNA Technologies (Canada), had the following sequences:
5′-HO-(CH2)6–S–S–(CH2)6GCATTGGTCTACAAGTGAATCTCGA-3′
for the thiol-modified probe DNA and TCGAGATTCACTTGTAGACCAATGC
for the target DNA. The oligonucleotides were hydrated in 10 mM TE
buffer to yield a concentration of 100 μM, and aliquots were
kept at −20 °C for long-term storage.
3
Fabrication of Graphene Field-Effect Transistors
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The 4-inch silicon wafers were used to produce chips (52 chips per wafer), each containing an array of GFETs using the high-throughput transfer technique described in (Emelianov et al., 2018; (link)Kireev et al., 2016) (link). In brief, the single-layer graphene was transferred onto a Si substrate with 300 nm SiO2 layer by a wet transfer and then patterned to form graphene channels via oxygen plasma etching (300 W, 200 sccm, 10 min) . Using e-beam-assisted evaporation of metals and lift-off of LOR-3B and AZ-5209-E photoresists, we deposited the 10 nm Ni and 70 nm Au metal stack. At the final step, a photostructurable resist SU-8 2002 (MicroChem) was spin-coated to form a ~2 µm thick passivation layer. After exposure, development, and post-exposure baking, the passivation layer, covering the metal feedlines as well as a partial area (<2 µm) of graphene-metal contacts, was formed to prevent current leakage during measurements in a liquid.
To perform multiplex measurements, the chips were wire-bonded (K&S 4524 Wire bonder) on a printed circuit board (PCB). To prevent solvent leakage during measurement and save the reagents during the biosensor assembly, a 5 mm diameter well punched in PDMS was glued by a two-component epoxy resin to the GFETs array area. The epoxy layer also protects wire bonds from unintentional damage during the chip operation.
To perform multiplex measurements, the chips were wire-bonded (K&S 4524 Wire bonder) on a printed circuit board (PCB). To prevent solvent leakage during measurement and save the reagents during the biosensor assembly, a 5 mm diameter well punched in PDMS was glued by a two-component epoxy resin to the GFETs array area. The epoxy layer also protects wire bonds from unintentional damage during the chip operation.
4
Fabrication of Multilayer Microfluidic Molds
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Example 1
The present Example describes mold fabrication.
SU-8 2002 (Microchem) was initially spun onto silicon wafers to facilitate adhesion of thicker SU-8 layers to the underlying substrate. SU-8 2100 was then spun on substrates to desired thickness and processed under standard protocols (see data sheet). For multilayer molds, an initial SU-8 2100 layer was defined via exposure, and hard-baked. A second layer SU-8 2100 layer was subsequently spun and the substrate was then processed under standard protocols. Substrates were silanized via vapor deposition of trichloro(1H,1H,2H,2H-perfluorooctyl)silane (Sigma) in a vacuum chamber. Polydimethylsiloxane (Fisher) was subsequently poured onto molds and degassed to remove air bubbles. PDMS was baked overnight at 60 C, removed from molds, and allowed to crosslink to completion at 90 C over 24 hours.
5
Fabrication of DFB Laser with Photoresists
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Two types of photoresists were used for the fabrication of a DFB: a negative type photoresist, SU-8 2002 (MicroChem), and a positive type photoresist, ma-P 1275 (Micro Resist Technology). Photoresist SU-8 2002 consisted of epoxy resin, photo acid generator, and cyclopentanone solvent. Photoresist ma-P 1275 consisted of novolac resin and the photoactive compound diazonaphthoquinone (DNQ). Rhodamine 6G (R6G) (Aldrich Chem.) was used as the laser dye. Cellulose acetate (CA, Aldrich Chem.) was used as the waveguide matrix in the laser device. Diacetone alcohol (DAA, Nacalai Tesque, Japan) was used as the solvent for CA. Polyvinyl alcohol (PVA, Nakalai Tesque, Japan) was used as an interlayer.
6
Fabrication of ITO Electrode Chip
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For the ITO electrode, the chip established in previous studies [42 (link),43 (link),44 (link)] was used. An ITO electrode with a thickness of 480 nm was patterned on slide glass (75 mm × 25 mm × 1.1 mm), and consisted of eight working electrodes, a common counter electrode, transmission lines, and terminal pads. Using spin coating and photolithography, an epoxy-based photoresist (SU-8 2002, Microchem, Newton, MA, USA) was used to provide a 2-μm-thick coating to insulate the transmission lines of the ITO electrode chip. The exposed working electrodes (WE) were disk-shaped with a radius of 250 μm and separated from the counter electrode (CE) by a distance of 3 mm. A polystyrene chamber was attached on the ITO electrode-based chip using adhesive silicone to provide a reservoir to contain the culture medium for the cells (Figure 1 a).
7
Synthesis and Characterization of Thiolated Monolayers
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
6-Mercapto-1-hexanol (MCH) (HS(CH 2 ) 6 OH, 97%), potassium hydroxide (KOH, 90%), hydrogen peroxide (50 wt.% in H 2 O), and potassium chloride (KCl, 99%) were obtained from Sigma (Germany). Sulfuric acid (96%) was purchased from BASF (Sweden). Ethanol (99.5%) was supplied by CCS Healthcare AB (Sweden). SU-8 2002 was obtained from MicroChem (USA). All chemicals were of analytical grade or better and were used as received. All aqueous solutions were prepared in UHQ water with resistivity higher than 18 MΩ × cm.
8
Fabrication of Graphene Field-Effect Transistors
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The 4-inch silicon wafers were used to produce chips (52 chips per wafer), each containing an array of GFETs using the high-throughput transfer technique described in (Emelianov et al., 2018; (link)Kireev et al., 2016) (link). In brief, the single-layer graphene was transferred onto a Si substrate with 300 nm SiO2 layer by a wet transfer and then patterned to form graphene channels via oxygen plasma etching (300 W, 200 sccm, 10 min) . Using e-beam-assisted evaporation of metals and lift-off of LOR-3B and AZ-5209-E photoresists, we deposited the 10 nm Ni and 70 nm Au metal stack. At the final step, a photostructurable resist SU-8 2002 (MicroChem) was spin-coated to form a ~2 µm thick passivation layer. After exposure, development, and post-exposure baking, the passivation layer, covering the metal feedlines as well as a partial area (<2 µm) of graphene-metal contacts, was formed to prevent current leakage during measurements in a liquid.
To perform multiplex measurements, the chips were wire-bonded (K&S 4524 Wire bonder) on a printed circuit board (PCB). To prevent solvent leakage during measurement and save the reagents during the biosensor assembly, a 5 mm diameter well punched in PDMS was glued by a two-component epoxy resin to the GFETs array area. The epoxy layer also protects wire bonds from unintentional damage during the chip operation.
To perform multiplex measurements, the chips were wire-bonded (K&S 4524 Wire bonder) on a printed circuit board (PCB). To prevent solvent leakage during measurement and save the reagents during the biosensor assembly, a 5 mm diameter well punched in PDMS was glued by a two-component epoxy resin to the GFETs array area. The epoxy layer also protects wire bonds from unintentional damage during the chip operation.
9
Multifunctional Cell-Based Biosensor Fabrication
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A 4-inch quartz glass wafer (Corning, USA) was used to fabricate interdigital electrodes (IDEs) and microelectrodes (MEs). As shown in Fig. 9a , we patterned 10 nm Ti/100 nm Au using the positive photoresist Microposit S1813 (Shipley, USA). The negative photoresist SU-8 2002 (Microchem, USA) was used to insulate the leads of IDEs and MEs. Two 100 μm diameter MEs were patterned in the middle area, and the center-to-center distance between the two MEs was 3 mm. Two circle-on-line interdigitated branches with a diameter of 90 μm were patterned in two side areas. The center distance of adjacent interdigitated branches was 110 μm, and the distance between the ME and IDE was 50 μm. Two reference electrodes were designed at the edge of the IDEs (Fig. 9b ). Finally, a polymethyl methacrylate (PMMA) chamber (5 mm diameter) was integrated for cell culture (Fig. 9c ).Construction of the multifunctional biosensor. ![]()
10
Fabrication of Micron-Scale SU-8 Patterns
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
We diced a silicon wafer into squared pieces of 22x22 mm. We used one piece as a substrate and spin-coated it with 290 μL of SU-8 2002 (Microchem) at 500 rpm for 10 seconds and then at 1000 rpm for 30 seconds. We obtained a ≈2 μm thick layer of SU-8 on the silicon surface. We soft baked the sample at 95°C for 2 minutes on a hot plate. We used a mask aligner (ABM) to expose the surface to 365 nm UV light through a chromium photomask (Compugraphics), delivering approximately 80 mJ/cm2. The mask design is made of parallel lines with thickness varying between 5 and 10 μm. The space between the lines, coated with chrome, can vary between 5 and 40 μm. We then performed a postexposure bake at 95°C for 2 minutes.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!