Viral rna extraction kit

Manufactured by Bioneer

Sourced in Cameroon

The Viral RNA Extraction Kit is a laboratory tool designed to extract and purify viral RNA from various sample types. It utilizes a series of steps to isolate and concentrate the viral genetic material, which is a crucial step in many downstream applications, such as viral detection, identification, and characterization.

Automatically generated - may contain errors

Lab products found in correlation

Nanodrop, by Thermo Fisher Scientific (2 mentions) Dna extraction kit, by Bioneer (1 mentions) Accuzol total rna extraction solution, by Bioneer (1 mentions) Dnase, by Omega Bio-Tek (1 mentions) Ptg19 t vector, by Vivantis Technologies (1 mentions)

7 protocols using viral rna extraction kit

Viral and Bacterial Nucleic Acid Extraction

Check if the same lab product or an alternative is used in the 5 most similar protocols

Viral RNA was isolated from MDBK infected with BVDV-NADL and BVDV-2 separately using the Bioneer viral RNA extraction kit (Korea) according to the manufacturer’s protocol. In addition, viral RNA was also isolated from 36 positive BVDV archived isolates and 30 field samples. RNA isolated from non-infected MDBK cells, Razi bovine kidney (RBK) cells, and FMDV were used as negative controls. The concentrations of the RNA extracts were measured using a NanoDrop (Thermo scientific, USA) at a wavelength of 260 nm.
DNA was extracted from P. multocida, E. coli O157:H7, as well as BoHV-1 and FLK-BLV, using a DNA extraction Kit (Bioneer, Korea) according to the manufacturer’s instructions. All extracted RNA and DNA were stored at −20 °C until used.

Askaravi M., Rezatofighi S.E., Rastegarzadeh S, & Seifi Abad Shapouri M.R. (2017). Development of a new method based on unmodified gold nanoparticles and peptide nucleic acids for detecting bovine viral diarrhea virus-RNA. AMB Express, 7, 137.

+ Open protocol

+ Expand

Viral RNA Extraction Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols

Columns, binding buffer and wash buffer were used from the Viral RNA extraction kit (Bioneer, Daejon, South Korea). Binding buffer 1 (2:1 etanol: binding buffer) and binding buffer 2 (5:1 etanol: binding buffer) was prepared. Cells were washed with PBS, incubated in lysis buffer (Accuzol™ Total RNA Extraction Solution, Bioneer, Daejon) for 5 minutes. The lysate was collected. The upper aqueous phase was collected after addition of dichloromethane. Binding buffer 1 was added to the sample, and then transferred through columns. The flow-through was collected for miRNA isolation as described previously [25 (link)]. The columns were treated with DNase (Omega bio-tek, Norcross, Georgia, USA). Binding buffer 2 was added to the flow-through, and the mixture was transferred through another binding column. After two subsequent washing steps, RNA and miRNA was eluted in RNase free-water.
The quality and quantity of the isolated miRNA and RNA was measured with NanoDrop1000 Version 3.8.1. (Thermo Fisher Scientific, Wilmington, USA).

Antal O., Hackler L J.r., Shen J., Mán I., Hideghéty K., Kitajka K, & Puskás L.G. (2014). Combination of unsaturated fatty acids and ionizing radiation on human glioma cells: cellular, biochemical and gene expression analysis. Lipids in Health and Disease, 13, 142.

+ Open protocol

+ Expand

BEFV Glycoprotein Gene Detection and Sequencing

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA was extracted from buffy coats using a viral RNA extraction kit (Bioneer; South Korea) according to the manufacturer’s protocol. Then, extracted RNA samples were reverse-transcribed using a kit (Yekta Tajhiz; Iran) to obtain cDNA. Screening of the positive BEFV samples was performed based on the amplification of the partial G gene via a nested PCR [30 (link), 31 (link)]. Primer sequences are indicated in Table 2.Table 2

List of primes used for detection and sequencing of glycoprotein (G) gene

Type		Primer Name	Sequence 5′-3′	Reference
Nested-PCR for Detection	First Run	G1F	ATGTTCAAGGTCCTCATAATTACC	32¹
	First Run	G4R	AATGATCAAAGAACCTATCATCAC
	Second Run	420F	AGAGCTTGGTGTGAATAC	31
	Second Run	420R	CCAACCTACAACAGCAGATA
Nested-PCR for sequencing	First Run	G1F	ATGTTCAAGGTCCTCATAATTACC	32¹
	First Run	G4R	AATGATCAAAGAACCTATCATCAC
	Second Run	G1F	ATGTTCAAGGTCCTCATAATTACC	32
		G1R	GCTTGTGTTGTATTAGGA
		G2F	GGAATACGGAGATGAATCAA	32
		G2R	ATTCTGTTCTATCTGTGTGC
		G3F	TTGAGGATGGAGAATGGTGG	32
		G3R	TACAACAGCAGATAAAAC
		G4F	AAATGGAATGATCTTTGTGG	32
		G4R	AATGATCAAAGAACCTATCATCAC

¹G4R primer was modified based on the Middle East strains of India 2019 (MN905763) and Israel 2000 (JN833630)

Rezatofighi S.E., Mirzadeh K, & Mahmoodi F. (2022). Molecular characterization and phylogenetic analysis of bovine ephemeral fever viruses in Khuzestan province of Iran in 2018 and 2020. BMC Veterinary Research, 18, 19.

+ Open protocol

+ Expand

Viral RNA Extraction from Plant Leaves

Check if the same lab product or an alternative is used in the 5 most similar protocols

The Viral RNA extraction kit (Bioneer, Daejeon, Republic of Korea) was used to extract viral RNA from plant leaves. A sample of 0.5 g of plant tissue was ground in the presence of the supplied RNA extraction buffer, and RNA was extracted according to the manufacturer’s instructions.

Reingold V., Eliyahu A., Luria N., Leibman D., Sela N., Lachman O., Smith E., Mandelik Y., Sadeh A, & Dombrovsky A. (2024). A Distinct Arabidopsis Latent Virus 1 Isolate Was Found in Wild Brassica hirta Plants and Bees, Suggesting the Potential Involvement of Pollinators in Virus Spread. Plants, 13(5), 671.

+ Open protocol

+ Expand

Mustard Comovirus Detection Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted from every bee individually using the standard phenol and guanidinium isothiocyanate (TriReagent, Cincinnata, OH, USA) protocol. Briefly, each bee was homogenized in 400 µL of BioTri (BioLab Ltd., Jerusalem, Israel), followed by 10 min incubation. A total of 80 µL of chloroform was added to each tube, followed by vortex, 5 min incubation, and 15 min centrifugation. The upper phase was mixed in a ratio of 1:1 (v:v) with 9 M LiCl in isopropanol, followed by 1 h incubation at −20 °C for precipitation. Following an 8 min centrifugation, the pellet was washed with 75% ethanol, and elution was performed with 40 µL DDW. The RNA from all the bees was pooled according to genus and enriched for viral RNA using the Viral RNA Extraction kit (Bioneer, Daejeon, Republic of Korea) according to the manufacturer’s instructions. The presence of the mustard comovirus was tested by RT-PCR followed by Sanger sequencing as detailed above.

+ Open protocol

+ Expand

Investigating RNA Viruses in Mealybug Hosts

Check if the same lab product or an alternative is used in the 5 most similar protocols

To test whether any of the three RNA viruses originate from the mealybug hosts, virions were purified from pools of: i) Mass-reared (MR) W + A. vladimiri (~0.7 g), ii) Field-collected A. vladimiri line without the AnvRV (RV -) (~0.2 g), iii) un-parasitiezed P. citri,(~0.7 g) and iv) P. citri, four days after parasitization by MR A. vladimiri, (~0.3 g) (see Table 1 for details).
Purification was done according to Luria et al., (2020) (link), with minor modifications. Briefly, the insects were homogenized in a TBE buffer, supernatant was filtered through a 0.45 µm membrane, placed on a 30% sucrose cushion, and subjected to ultracentrifugation at 242,922 g for 2 h. Then, RNA was extracted from the pellet using the Viral RNA extraction kit (Bioneer, Daejeon, South Korea). Detection of the three viruses (AnvRV, AnvIFV and AnvDV) in those samples was carried by cDNA synthesis and PCRs as described below.

Izraeli Y., Lepetit D., Atias S., Mozes-Daube N., Wodowski G., Lachman O., Luria N., Steinberg S., Varaldi J., Zchori-Fein E, & Chiel E. (2022). Genomic characterization of viruses associated with the parasitoid Anagyrus vladimiri (Hymenoptera: Encyrtidae). The Journal of general virology, 103(12).

+ Open protocol

+ Expand

BEFV G Gene Amplification and Sequencing

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA was extracted from buffy coats using a viral RNA extraction kit (Bioneer; South Korea) according to the manufacturer's protocol. Then, extracted RNA samples were reverse-transcribed using a kit (Yekta Tajhiz; Iran) to obtain cDNA. Screening of the positive BEFV samples was performed based on the ampli cation of the partial G gene via a nested PCR [30, 31] . Primer sequences are indicated in Table 2.
Sequencing the full-length G gene BEFV G gene was ampli ed as described by Hsieh et al with some modi cation [32] . A nested PCR was designed according to primers introduced by Hsieh et al. In the rst run, G1F and G4R primers were used to amplify an 1872 length fragment with the following protocol: 94 C for 2 min, 25 cycles of 94 C for 50 s, 50 C for 50 s, 72 C for 75 s, and a nal extension of 72 C for 5 min. In the second run, the PCR product was used as a template and G1-G4 fragments were ampli ed. PCR products were directly sequenced or subcloned into the pTG19-T vector (Vivantis; Malaysia) using standard techniques and then sequenced again. Sequencing was performed by Bioneer Company (South Korea) with the same PCR primers in two directions. Sequences were trimmed with BioEdit software version 7.0.4.1 (mbio, Inc, North Carolina, USA). Obtained sequences were submitted to the GenBank and are available under the accession numbers MZ51169 and MZ51168.

Rezatofighi S.E., Mirzadeh K., & Mahmoodi F. (2021). Molecular Characterization and Phylogenetic Analysis of Bovine Ephemeral Fever Viruses in Khuzestan Province of Iran From 2018 to 2020.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!