provided by Astellas Pharma Inc., Tokyo, Japan) for 18h at 37C in a humidified atmosphere with 5% CO2, and then washed before use. Next, T helper (Th) cells were separated from DO 11.10 TCR Tg mouse spleen cells using an EasySep Negative Selection Mouse CD4 + T Cell Enrichment Kit (StemCell Technologies, Vancouver, BC, Canada) and then treated with mouse anti-CD62L monoclonal antibody (clone lam1-116, IgG2a) (1 g per 1 × 10 6 cells; Santa Cruz Biotechnology, Santa Cruz, CA, USA) in RPMI 10 for 1 h on ice. The Th cells that had been reacted with anti-CD62L antibody were then purified using a CELLection TM Pan Mouse IgG Kit (Invitrogen Dynal AS, Oslo, Norway), and used as naïve Th cells. The naïve Th cells (5 × 10 5 cells/mL) were cultured with the above mast cells (1 × 10 5 cells/mL) in the presence of 30 nM OVA peptide (323-ISQAVHAAHAEINEAGR-339; obtained from Operon Biotechnologies, Tokyo, Japan) for 5 days at 37°C. The cells were then stimulated with 50 ng/mL phorbol 12-myristate 13-acetate (PMA) (Sigma) and 500 ng/mL ionomycin (Sigma) for 24 h at 37°C. The cell supernatants were finally removed and tested for production of interferon (IFN)- and IL-4 using enzyme-linked immunosorbent assay (ELISA) kits (R&D Systems).
Cellection pan mouse igg kit
The CELLection Pan Mouse IgG Kit is a magnetic bead-based product designed for the isolation and purification of mouse immunoglobulin G (IgG) from cell culture supernatants or other biological samples. It uses magnetic beads coated with pan-specific anti-mouse IgG antibodies to capture and separate mouse IgG from the sample.
Lab products found in correlation
11 protocols using cellection pan mouse igg kit
Mast Cell-Th Cell Interaction Assay
provided by Astellas Pharma Inc., Tokyo, Japan) for 18h at 37C in a humidified atmosphere with 5% CO2, and then washed before use. Next, T helper (Th) cells were separated from DO 11.10 TCR Tg mouse spleen cells using an EasySep Negative Selection Mouse CD4 + T Cell Enrichment Kit (StemCell Technologies, Vancouver, BC, Canada) and then treated with mouse anti-CD62L monoclonal antibody (clone lam1-116, IgG2a) (1 g per 1 × 10 6 cells; Santa Cruz Biotechnology, Santa Cruz, CA, USA) in RPMI 10 for 1 h on ice. The Th cells that had been reacted with anti-CD62L antibody were then purified using a CELLection TM Pan Mouse IgG Kit (Invitrogen Dynal AS, Oslo, Norway), and used as naïve Th cells. The naïve Th cells (5 × 10 5 cells/mL) were cultured with the above mast cells (1 × 10 5 cells/mL) in the presence of 30 nM OVA peptide (323-ISQAVHAAHAEINEAGR-339; obtained from Operon Biotechnologies, Tokyo, Japan) for 5 days at 37°C. The cells were then stimulated with 50 ng/mL phorbol 12-myristate 13-acetate (PMA) (Sigma) and 500 ng/mL ionomycin (Sigma) for 24 h at 37°C. The cell supernatants were finally removed and tested for production of interferon (IFN)- and IL-4 using enzyme-linked immunosorbent assay (ELISA) kits (R&D Systems).
Generation of Murine LDCs from Bone Marrow
Isolation of Rat Pulmonary Microvascular Endothelial Cells
Islet Cell Purification and Culture
Isolation and Characterization of MAIT Cells
The real-time PCR was performed as previously described for on an Viia™ 7 Real-time PCR System (Applied Biosystems) using KAPA PROBE FAST qPCR Master Mix (2X) Universal Kit (Kapa Biosystems), except for the MAIT cell assay (Vα7.2-Jα33/12/20) the following primers and probes were used: Vα7.2 forward primer (TCCTTAGTCGGTCTAAAGGGTACAG), 1 µM; Jα33 reverse primer (CCAGCGCCCCAGATTAA), 200 nM; Jα12 reverse primer (GTCCCACTCCCGAAGATCAATTT) 400 nM; Jα20 reverse primer (TGTGGTTCCGGCTCCAAAG), 400 nM; Vα7.2 probe (6-FAM/AGGTTGCTC/ZEN/CACAGGTAGCTCTAGG/Iowa Black FQ), 400 nM. The efficiency of the Vα7.2-Jα33/12/20 and β-2-microglobulin (β2M) assays were 92.5 and 102.3%, respectively.
Islet Cell Purification and Culture
15040066), and dissociated using TrypLE Select Enzyme solution (ThermoFisher
12563011) at 37°C, with occasional trituration. For human islets, the
dissociated cells were purified into β cell and non-β cell
fractions using mouse anti-human NTPDase3 antibodies (Ectonucleotidases
antibodies hN3-B3S) and CELLection Pan Mouse IgG kit (ThermoFisher
11531D).35 (link) Cells
were plated on sterilized glass shards and cultured overnight at 37°C
before experiments. For mouse cells, culture media was RPMI-1640
supplemented with 10% (v/v) fetal bovine serum (ThermoFisher A31605), 1%
(v/v) penicillin-streptomycin (Fisher Scientific 15070063), and 2 mM
L-glutamine (Fisher Scientific 25030081). For human cells, the media was
adjusted to contain 8 mM glucose.
Isolating Primary Epithelial Cells
Murine Bone Marrow-Derived Langerhans Cells
Isolation and Culture of Mouse Langerhans Cells
Immunomagnetic Beads for Cell Isolation
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!