Propyleneglycol monomethylether acetate pgmea

EPON resin SU-8 (Momentive Ltd., Waterford, NY, USA) was used in the fabrication of suspended-microbeams because of its good properties including highly transparent in both visible and near infrared band range, chemical resistance, and good mechanical strength. The refractive index of photopolymerized SU-8 at the wavelength of around 1550 nm is 1.57 [27 (link)].
Octoxyphenylphenyliodoniumhexafluoroantimonate (OPPI) (Hampford Research Inc., Stratford, ON, Canada) and tributylamine (Meryer Chemical Technology Co., Ltd., Shanghai, China) were used as photoacid generator and inhibitor, respectively. 2-(2H-Benzotriazol-2-yl)-4,6-bis(1-methyl-1-phenylethyl)phenol (i.e., Tinuvin 234) (Sigma-Aldrich Inc., St. Louis, MO, USA) was adopted as UV absorption agent to control light penetration depth so as to enhance the vertical distinguishability in the printing process. These compositions were dissolved by cyclopentanone (Sigma-Aldrich Inc., St. Louis, MO, USA) in a weight ratio of OPPI/tributylamine/Tinuvin 234/SU-8 = 2:0.014:0.2:100. Propyleneglycol monomethylether acetate (PGMEA) (Sigma-Aldrich Inc., St. Louis, MO, USA) was used as developer.

Gold (III) chloride and Aflatoxin M1 (Afl M1) were purchased from Sigma-Aldrich. Sodium citrate and sodium chloride were procured from Sisco Research Laboratories Pvt. Ltd. (SRL), India. The 21-mer aptamer sequence of Afl M1 (ACTGCTAGAGATTTTCCACAT (5′ to 3′)), The Ochratoxin aptamer sequence used was 36-mer 5-GATCGGGTGTGGGTGGCGTAAAGGGAGCATCGGACA-3 and the ssDNA oligonucleotides were synthesized by GCC biotech, India. Stock solutions (100 μM) of aptamers were dissolved in ultrapure water then stored at −20 °C. Whatman filter paper was purchased from GE healthcare, India. Trysulfonium hexaflurophosphate and Propylene glycol monomethyl ether acetate (PGMEA) were procured from Sigma-Aldrich. All reagents were of analytical grade and used as received.