Cas9 crispr mediated genome editing

Manufactured by Cyagen

Sourced in United States

Cas9/CRISPR-mediated genome editing is a gene-editing technology that utilizes the CRISPR-Cas9 system to modify target DNA sequences. The core function of this system is to precisely locate and cut specific genomic regions, enabling targeted gene insertions, deletions, or modifications.

Automatically generated - may contain errors

Lab products found in correlation

C57bl 6j mice, by Charles River Laboratories (1 mentions)

Spelling variants of this product

CRISPR/Cas9 (9 citations) CRISPR/Cas9-mediated genome editing system (6 citations) CRISPR/Cas9‐mediated genome editing technology (3 citations)

3 protocols using cas9 crispr mediated genome editing

Cysteine-Glutathione Peroxidase Knockin Mice

Check if the same lab product or an alternative is used in the 5 most similar protocols

The two gene knockin mouse stains harboring cGPX4 (R26^cGPX4/cGPX4, project No. KICMS181221LY4) and iGPX4 (R26^iGPX4/iGPX4, project No. KICMS170117PL1) respectively were generated by Cas9/CRISPR-mediated genome editing (Cyagen Biosciences, Santa Clara, CA, USA). For R26^cGPX4/cGPX4 and R26^iGPX4/iGPX4 mice generation, the “CAG-mouse cGPX4 cDNA (NM_008162.3)-polyA” cassette and “CAG-mouse iGPX4 cDNA (NM_001037741.3)-polyA” cassettes were inserted into intron 1 of Rosa26 respectively under the guide of gDNA. The homology arms were generated by PCR using BAC clone as template. The pups were genotyped by PCR followed by sequencing analysis confirmation for positive targeting, which was further verified by Southern blot. See Supporting Information Fig. S3A–S3D (R26^cGPX4/cGPX4) and Fig. S4A–S4D (R26^iGPX4/iGPX4) for more detailed information on the two strains of knockin mice. These mice were backcrossed for at least six generations with C57BL/6J mice (Vital River Laboratories).

Tong J., Li D., Meng H., Sun D., Lan X., Ni M., Ma J., Zeng F., Sun S., Fu J., Li G., Ji Q., Zhang G., Shen Q., Wang Y., Zhu J., Zhao Y., Wang X., Liu Y., Ouyang S., Sheng C., Shen F, & Wang P. (2022). Targeting a novel inducible GPX4 alternative isoform to alleviate ferroptosis and treat metabolic-associated fatty liver disease. Acta Pharmaceutica Sinica. B, 12(9), 3650-3666.

+ Open protocol

+ Expand

Generation of FOXI3 Variant Mice

Check if the same lab product or an alternative is used in the 5 most similar protocols

C57BL/6 mice carrying the three variants p.(Arg220Trp), p.(Arg222Gln), and p.(Arg224His), orthologous to FOXI3:p.(Arg236Trp), p.(Arg238Gln) and p.(Arg240His) in one allele were generated by Cas9/CRISPR-mediated genome editing (Cyagen Biosciences, Guangzhou, China). Briefly, a gRNA (TCGGAAGCGAAGGCGCCGCG-CGG) to the mouse Foxi3 gene, a donor oligo with a targeting sequence containing p.(Arg220Trp) (codon from CGG to TGG), p.(Arg222Gln) (codon from CGA to CAA) and p.(Arg224His) (codon from CGC to CAC) mutations sites, and Cas9 protein were co-injected into fertilized mouse eggs to generate targeted knock-in offspring. The genotype of pups was determined by Sanger sequencing using 5′-CATGCACTAAAGTGTCTTGGAACAT-3′ and 5′-TTAAAGGTGCTGAGGAAAGTGTTG-3′ as PCR primer and 5′-GTTGAGACACGGAGTGGAGG-3′ as sequencing primer. Heterozygous mice Foxi3^{R220W-R222Q-R224H/+} were mated with Foxi3^+/+ C57BL/6 mice to acquire heterozygous progenies, which were then intercrossed to generate homozygous Foxi3^{R220W-R222Q-R224H/R220W-R222Q-R224H} mice.

Mao K., Borel C., Ansar M., Jolly A., Makrythanasis P., Froehlich C., Iwaszkiewicz J., Wang B., Xu X., Li Q., Blanc X., Zhu H., Chen Q., Jin F., Ankamreddy H., Singh S., Zhang H., Wang X., Chen P., Ranza E., Paracha S.A., Shah S.F., Guida V., Piceci-Sparascio F., Melis D., Dallapiccola B., Digilio M.C., Novelli A., Magliozzi M., Fadda M.T., Streff H., Machol K., Lewis R.A., Zoete V., Squeo G.M., Prontera P., Mancano G., Gori G., Mariani M., Selicorni A., Psoni S., Fryssira H., Douzgou S., Marlin S., Biskup S., De Luca A., Merla G., Zhao S., Cox T.C., Groves A.K., Lupski J.R., Zhang Q., Zhang Y.B, & Antonarakis S.E. (2023). FOXI3 pathogenic variants cause one form of craniofacial microsomia. Nature Communications, 14, 2026.

+ Open protocol

+ Expand

Generating BMP15 R86C Mutant Mice

Check if the same lab product or an alternative is used in the 5 most similar protocols

C57BL/6 mice harboring BMP15 R86C mutation (equivalent to BMP15 R88C in humans) were generated by Cas9/CRISPR-mediated genome editing (Cyagen Biosciences). Briefly, DNA fragment carrying BMP15 targeting gRNA (CCAATCGTGCGGTTCTCCCTTGG) was inserted into the gRNA cloning vector. The oligo donor with targeting sequence, flanked by 124-bp homologous sequences combined on both sides (5′GAGGTACATGCTCAAGTTATACCATCG TTCGGCTGACCCGCATGGCCATCCAAGGGAGAATTGCACGATTGGAGCGAAAATGGTGAGGCTGGTAAAGfCCGTCGGCCAACACAGTAAGGCCTCCC3′) was synthesized (Integrated DNA Technologies). The BMP15 gRNA and Cas9 mRNA were generated by in vitro transcription and co-injected with oligo donor into fertilized eggs.

Liu Y., Fan H., Kang X., Hao Y., Wang N., Zheng H., Li Y, & Kang S. (2024). A rare germline BMP15 missense mutation causes hereditary ovarian immature teratoma in human. Proceedings of the National Academy of Sciences of the United States of America, 121(10), e2310409121.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!