Illustra nap 25

Manufactured by GE Healthcare

The Illustra NAP-25 is a lab equipment product from GE Healthcare. It is a nucleic acid purification system designed for the extraction and purification of DNA and RNA from a variety of sample types. The Illustra NAP-25 utilizes a rapid and efficient method to isolate high-quality nucleic acids for downstream applications.

Automatically generated - may contain errors

Lab products found in correlation

Nanodrop, by Thermo Fisher Scientific (2 mentions) High resolution microarray scanner, by Agilent Technologies (1 mentions) Cy3 mono reactive dye pack, by GE Healthcare (1 mentions) Nuclease free water, by Thermo Fisher Scientific (1 mentions) Kimtech polypropylene wipes, by Kimberly-Clark (1 mentions) Thrombin, by Prolytix (1 mentions) Sonopuls hd 2070, by Bandelin (1 mentions)

2 protocols using illustra nap 25

DNA Microarray Protein-Binding Assay

Check if the same lab product or an alternative is used in the 5 most similar protocols

The chemicals used were IgE (Fitzgerald), Thrombin (Haematologic Technologies, Inc.), BSA and HSA (Sigma), neuropeptide Y (Pheonix Pharmaceuticals), Illustra NAP-25 desalting columns and Cy3 Mono-Reactive Dye Pack (GE Healthcare), NanoDrop (Thermo Scientific), nuclease free water (Gibco). Microarray equipment consisted of the following: custom 8 × 15 k DNA microarrays, 8 × 15 k gasket slides, ozone barrier slides, hybridization chambers, scanner cassettes, hybridization oven, and High-resolution Microarray Scanner (all Agilent) and slide rack and wash dishes (Shandon) and Kimtech polypropylene wipes (Kimberly-Clark). All DNA was purchased through IDT:

4A018: GGTTGGTTTTTCAATCAGCGATCGCGGAATCCAGGGTTAGGCGGCCAACC (with and without 3′-T₁₀-Biotin moiety).

TFBS: GGTTGGTGTGGTTGG.

Buffers: Binding [PBSMTB]-1x PBS (8.1 mM Na₂HPO₄, 1.1 mM KH₂PO₄, 2.7 mM KCl, 137 mM NaCl, pH 7.4) + 1 mM MgCl₂ + 0.1% Tween-20 and 1% BSA; Washing [PBSM]-1x PBS (8.1 mM Na₂HPO₄, 1.1 mM KH₂PO₄, 2.7 mM KCl, 137 mM NaCl, pH 7.4) + 1 mM MgCl₂; Rinse [R]-1/4 dilution of PBSM and nuclease free water.

Martin J.A., Mirau P.A., Chushak Y., Chávez J.L., Naik R.R., Hagen J.A, & Kelley-Loughnane N. (2015). Single-Round Patterned DNA Library Microarray Aptamer Lead Identification. Journal of Analytical Methods in Chemistry, 2015, 137489.

+ Open protocol

+ Expand

Purification of Recombinant AhbD Variants

Check if the same lab product or an alternative is used in the 5 most similar protocols

Recombinant wild type AhbD (wt AhbD) from M. barkeri and the AhbD variants (AhbD C19A/C23A and AhbD C321A/C324A) were purified by IMAC. The cell pellet was resuspended in buffer A (50 mM Tris/HCl, pH 7.5, 300 mM NaCl, 20 mM imidazole) and the cells were disrupted using a French Press system (1000 psi). The soluble protein fraction was obtained by ultracentrifugation (60 min, 175 000 × g, 4 °C). The supernatant was sonicated twice using a Sonopuls HD 2070 (Bandelin, Berlin, Germany) equipped with a KE 76 tip (1 min, 4 × 10%) and afterwards loaded on a Ni-NTA column by gravity flow. The column was washed with 10 column volumes (CV) of buffer A before eluting the bound proteins with 6 CV of buffer A containing 300 mM imidazole. The protein content of the elution fractions was analyzed by SDS-polyacrylamide gel electrophoresis and the fractions containing recombinant AhbD were pooled. The final buffer exchange against buffer A without imidazole (= buffer B) was performed with a NAP-25 Sephadex column (Illustra NAP-25, GE Healthcare). The purified proteins were stored at 4 °C.

Kühner M., Schweyen P., Hoffmann M., Ramos J.V., Reijerse E.J., Lubitz W., Bröring M, & Layer G. (2016). The auxiliary [4Fe–4S] cluster of the Radical SAM heme synthase from Methanosarcina barkeri is involved in electron transfer †Electronic supplementary information (ESI) available: The cyclic voltammetry experiments, the binding assays with the substrate analogs, the determination of Kd values, the SAM cleavage assays with the substrate analogs, the decarboxylase activity assays with the substrate analogs and the synthesis and characterization of Zn-COPRO III. See DOI: 10.1039/c6sc01140c. Chemical Science, 7(7), 4633-4643.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!