Dh5 alpha competent cells

To evaluate the promoting activity and regulatory element of SbaP, a promoter-luciferase cassette was constructed. All primers used to amplify specific fragments by PCR method are listed in Table 2. PCR products were ligated into pCR2.1-TOPO vectors (Invitrogen, NY, USA) and then subcloned into the Sac I/Bgl II site of pGL4.10 [Luc2] vector (Promega, CA, USA). The serial-deleted fragments of SbaP were constructed using the restriction enzymes listed in Table 3. The plasmid pGL-SbaP was digested by specific enzymes, blunted end by DNA polymerase I, Large (Klenow) Fragment, self-ligated using T4 ligase and then transformed into DH5-alpha competent cells (NEB, MA, USA).

The Lenti-X Tet-On 3G tetracycline-inducible expression system is commercially available and purchased through Takara Bio (Takara Bio USA Inc, Shiga, Japan). The Lenti-LucOS plasmid was a gift from Tyler Jacks laboratory (Addgene plasmid #22777). The LucOS gene contains the luciferase gene conjugated to two chicken ovalbumin antigens (MHC I and II restricted) as well as a synthetic MHCI antigen. These antigens are not endogenously produced by tumors but have been used previously to study T cell biology in HCC making them a well-accepted model. The LucOS gene was amplified using a forward primer containing the ApaI restriction enzyme site (TAGCTGGGCCCATGGAAGACGCCAAAAACATAAAG) and reverse primer containing the NdeI restriction enzyme site (TCGATGCATATGTTAC AAGTCCTCTTCAGAAATAAGC). After amplification of the LucOS gene, the product and the Lenti-Tre3G plasmid were digested with ApaI and NdeI (New England Biolabs, Ipswich MA). The two digested products were then ligated together to create a Lenti-Tre3G-LucOS plasmid. Transformation was done using DH5alpha competent cells (New England Biolabs, Ipswich MA). Plasmid expansion was then done using Qiagen Miniprep kit (Qiagen, Hilden Germany).