Cell transfection was achieved in SGC7901/Tax and BGC823/Tax cells by performing Lipofectamine 2000 (Invitrogen, USA). The small-hairpin RNA targeting circ_002136 (si-circ_002136) and its negative control (si-NC), miR-16-5p mimics/inhibitors and its negative control miR-NC were provided by GenePharma (Shanghai, China). To construct stable circ_002136 low-expressing cell lines, lentivirus-mediated short-hairpin RNA against circ_002136 (sh-circ_002136) and its negative control sh-NC were transfected into SGC7901/Tax and BGC823/Tax cells, and 2 mg/mL puromycin was administrated to select stable expression colonies. pcDNA-HMGA1, an overexpression plasmid for HMGA1, was provided by GenePharma, and the empty pcDNA vector was set as negative control (pcDNA). Referring to the manufacturer’s protocols, cells were seeded on six-well plates, 24 h before transfection. After 48 h transfection at 37°C and 5% CO2, the cells were harvested for the next experiments.
Pcdna hmga1
Manufactured by GenePharma
PcDNA-HMGA1 is a plasmid vector designed for the expression of the HMGA1 gene. It contains the necessary regulatory elements to facilitate the expression of the HMGA1 protein in transfected cells. The core function of this product is to provide a tool for researchers to study the role and expression of the HMGA1 gene.
Automatically generated - may contain errors
Lab products found in correlation
Si nc, by GenePharma (1 mentions)
Mir nc, by GenePharma (1 mentions)
Lipofectamine 2000, by Thermo Fisher Scientific (1 mentions)
Fetal bovine serum (fbs), by Wisent (1 mentions)
Mkn 45 cl 0292, by Procell (1 mentions)
Ags crl 1739, by American Type Culture Collection (1 mentions)
Lipofectamine 3000 reagent, by Thermo Fisher Scientific (1 mentions)
Snu 1 crl 5971, by American Type Culture Collection (1 mentions)
Si hmga1, by RiboBio (1 mentions)
Lipofectamine 3000, by Thermo Fisher Scientific (1 mentions)
3 protocols using pcdna hmga1
1
Modulating Circular RNA circ_002136 in Gastric Cancer
2
Gastric Cancer Cell Line Cultivation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Two human GC cell lines, SNU-1 (CRL-5971) and AGS (CRL-1739) were procured from American Type Culture Collection (Manassas, VA, USA), and another two human GC cell lines, KATO III (CL-0372) and MKN-45 (CL-0292) from Procell Life Science & Technology Co., Ltd. (Wuhan, China). Human normal gastric epithelial cell line, GES-1 (SCSP-308), was procured from CCTCC (Shanghai, China). Roswell Park Memorial Institute-1640 medium encompassing 10% fetal bovine serum (FBS, Wisent, Montreal, Canada) and 1% antibiotics (100 U/mL penicillin G and 100 mg/mL streptomycin) was adopted for incubation of all aforesaid cell lines at 37ºC with 5% CO2.
GenePharma (Shanghai, China) provided short hairpin RNA (sh)-SNHG22 1, 2, 3#, miR-361-3p mimic/inhibitor and their respective controls. The overexpression plasmid pcDNA-HMGA1 was designed and synthesized by GenePharma, and the empty PDNA3.1 vector served as the control. Then, cell transfection was conducted based on protocols of Lipofectamine 3000 reagent (Invitrogen, Carlsbad, CA, USA).
GenePharma (Shanghai, China) provided short hairpin RNA (sh)-SNHG22 1, 2, 3#, miR-361-3p mimic/inhibitor and their respective controls. The overexpression plasmid pcDNA-HMGA1 was designed and synthesized by GenePharma, and the empty PDNA3.1 vector served as the control. Then, cell transfection was conducted based on protocols of Lipofectamine 3000 reagent (Invitrogen, Carlsbad, CA, USA).
3
CircRNA and HMGA1 Modulation in Endometrial Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Small interfering RNA (siRNA) targeting hsa_circ_0039569 (si-circ, 1: TCCTTTAAAATAGTGCCCCTA; 2: ATCCTTTAAAATAGTGCCCCT) and HMGA1 (si-HMGA1: ACTGGAGAAGGAGGAAGAG), miR-197 inhibitor (GCUGGGUGGAGAAGGUGGUGAA), and their negative controls were synthesized by Guangzhou RiboBio (China). The overexpression vectors pcDNA-hsa_circ_0039569 (ov-circ) and pcDNA-HMGA1 (ov-HMGA1) were constructed by Shanghai GenePharma. HEC-1-B or Ishikawa cells were transfected with the above plasmid via Lipofectamine 3000 (Invitrogen) as previously reported [16 (link)]. Transfection efficiency was detected by qRT–PCR or Western blot.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!