Livers were excised from another cohort of male mice treated and exposed in an identical manner [1 (link)]. Livers were snap-frozen in liquid nitrogen and stored in -80°C, then thawed over ice for subsequent preparation of RNA [31 (link)]. We used a small volume spectrophotometer (Nanodrop, Thermo Scientific) to assess RNA concentration and purity. A commercial kit (SuperScript III for qRT-PCR, Invitrogen) was used to convert RNA into cDNA. Liver Cyp7a1, Cyp7b1, Cyp8b1, Baat, and Slc10a1 mRNA abundances were quantified using real time PCR (7300 Real-Time PCR Systems, Applied Biosystems) with SYBR-green detection and normalized to 36B4 ribosomal RNA (Rplp0). Primers for these genes were as follows: Rplp0: Forward: GCTCCAAGCAGATGCAGCA , Reverse: CCGGATGTGAGGCAGCAG . Cyp7a1: Forward: GGCATCTCAAGCAAACACCA , Reverse: GCTTTCATTGCTTCAGGGCT . Cyp8b1: Forward: CCCATAAGACGCCATCCCTC , Reverse: AAGTGTGGGTGAGCCATCAG . Baat: Forward: GGTTGCTGTAAAACTACTGTTTTGG , Reverse: TGTGCACAGGCTCATCAACA . Slc10a1: Forward: ACCCTACGTCCTCAAGGCAG , Reverse: AGCCAGTAAGTGTGGTGTCA . The ΔΔCt method was used to assess changes in the mRNA abundance.
Superscript 3 for qrt pcr
Manufactured by Thermo Fisher Scientific
Sourced in United States
SuperScript III is a reverse transcriptase enzyme used for reverse transcription in quantitative real-time PCR (qRT-PCR) applications. It is designed for high-sensitivity and efficient cDNA synthesis from RNA templates.
Automatically generated - may contain errors
Lab products found in correlation
Nanodrop, by Thermo Fisher Scientific (3 mentions)
7300 real time pcr system, by Thermo Fisher Scientific (2 mentions)
Rneasy mini kit, by Qiagen (2 mentions)
Sso universal it sybr green supermix, by Bio-Rad (2 mentions)
Prime pcr assay h384 plates for mitochondrial apoptosis, by Bio-Rad (2 mentions)
Egfr signaling pathways, by Bio-Rad (2 mentions)
Rnalater, by Qiagen (1 mentions)
5 protocols using superscript 3 for qrt pcr
1
Quantitative RT-PCR Analysis of Liver Gene Expression
2
Quantifying Gene Expression in Human and Mouse Cells
3
Quantifying Gene Expression in Human and Mouse Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was extracted from both human and mouse cells using the RNeasy Mini Kit (Qiagen, Germany) according to the manufacturer’s instructions. Complementary DNA (cDNA) libraries were constructed using SuperScript III for qRT-PCR (Invitrogen Life Technologies, USA). Quantitative real-time polymerase chain reaction (qRT-PCR) was performed using the Sso Universal IT SYBR green supermix (BioRad, USA). Gene expression in human primary cell cultures were determined after template amplification using the Prime PCR assay H384 plates for Mitochondrial Apoptosis and EGFR Signaling Pathways (BioRad, USA) according to the manufacturer’s instructions. Gene expression in the mouse corticotroph cells and AtT-20 cells were determined using primers designed for epidermal growth factor receptor (EGFR), pro-opiomelanocortin (POMC), and phorbol-12-myristate-13-acetate-induced protein 1 (PMAIP1) (Table S11 ). Relative gene expression was calculated using the ΔCt method with GAPDH as the housekeeping gene.
4
Quantitative Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was prepared as previously described (21 (link)). RNA concentration and purity was determined using a small volume spectrophotometer (Nanodrop, Thermo Scientific, USA). RNA was converted into cDNA using a commercial kit (SuperScript III for qRT-PCR, Invitrogen). All expression values were normalized to 36B4 expression using the ΔΔCt method. Primers for Rplp0 (36B4), Cfd, Cx3cl1, Il23a (p19), Il17a, and Ccl20 (MIP3α) have all been described previously (16 (link), 22 (link)). Primers for Il1α were forward – cggcaaagaaatcaagatgg and reverse ttcagagagagatggtcaatgg ; for Il1β forward – ctgtgtctttcccgtggacc and reverse – cagctcatatgggtccgaca ; and for IL-6 forward – ccggagaggagacttcacag and reverse – cagaattgccattgcacaac .
5
Quantifying Lung mRNA Abundances
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
After excision, the right lung was immersed in RNAlater (Qiagen) for subsequent preparation of RNA [33 (link)]. A small volume spectrophotometer (Nanodrop, Thermo Scientific) was used to assess RNA concentration and purity and a commercial kit (SuperScript III for qRT-PCR, Invitrogen) was used to convert RNA into cDNA. Gclc mRNA abundance was quantified using real time PCR (7300 Real-Time PCR Systems, Applied Biosystems) with SYBR-green detection and normalized to 36B4 ribosomal RNA (Rplp0). Primers for Gclc were forward–TGTGGTATTCGTGGTACTGCT and CTGGGCCACTTTCATGTTCTC. Primers for Gsta1 were forward: ACCTGATGCACTCCATTCTG and reverse: GCTGGACTGTGAGCTGAGTG . Primers for Rplp0 were as described [33 (link)]. The ΔΔCt method was used to assess changes in mRNA abundances.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!