Genomic DNA was purified using NucleoSpin Tissue XS (Clontech). After sodium bisulfite treatment using the EpiTect Fast DNA Bisulfite Kit (QIAGEN), bisulfite-converted DNA was amplified by PCR and sub-cloned into the pCR4.1-TOPO Vector (Invitrogen). PCR primers were previously described (Ohkura et al., 2012 (link)). Plasmids from 16–32 colonies were purified and sequenced.
Pcr4.1 topo vector
Manufactured by Thermo Fisher Scientific
The PCR4.1-TOPO Vector is a cloning vector designed for direct insertion of PCR products. It contains a linearized plasmid with single 3' thymidine (T) overhangs, allowing for efficient ligation of PCR products with complementary adenine (A) overhangs. The vector also includes a T7 promoter and a range of selection markers for use in various host organisms.
Automatically generated - may contain errors
Lab products found in correlation
3 protocols using pcr4.1 topo vector
1
Genomic DNA Bisulfite Sequencing
2
Genomic DNA Bisulfite Sequencing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genomic DNA was purified using NucleoSpin Tissue XS (Clontech). After sodium bisulfite treatment using the EpiTect Fast DNA Bisulfite Kit (QIAGEN), bisulfite-converted DNA was amplified by PCR and sub-cloned into the pCR4.1-TOPO Vector (Invitrogen). PCR primers were previously described (Ohkura et al., 2012 (link)). Plasmids from 16–32 colonies were purified and sequenced.
3
Cloning and Sequencing of 1-FEH Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Amplifications were performed with GoTaq Long Range PCR master mix (Promega) according to manufacturer’s instruction with a Tm of 50°C, 35 cycles, elongation time of 7 min in 10 μl volumes with 100 ng of gDNA with primers 1FEH2a-28F CTTTTTCTCCATATGTTGTCG and 1FEH2a-5744R CAAGGAATACAGCAACAAAGAATG.
For both 1-FEH I and 1-FEH IIb, inserts were gel-purified with Nucleospin Gel extraction kit (Macherey Nagel), inserts were cloned in PCR4.1 Topo vector (Invitrogen) and electroporated in TOP10 E. coli (Invitrogen). Sanger sequencing of the inserts was performed at Macrogen (The Netherlands).
For both 1-FEH I and 1-FEH IIb, inserts were gel-purified with Nucleospin Gel extraction kit (Macherey Nagel), inserts were cloned in PCR4.1 Topo vector (Invitrogen) and electroporated in TOP10 E. coli (Invitrogen). Sanger sequencing of the inserts was performed at Macrogen (The Netherlands).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!