Ecodry cdna synthesis kit

Manufactured by Takara Bio

Sourced in United States

The Ecodry cDNA synthesis kit is a tool used for the reverse transcription of RNA into complementary DNA (cDNA). It provides the necessary reagents and enzymes to convert RNA into a DNA template that can be used for various downstream applications, such as gene expression analysis and PCR amplification.

Automatically generated - may contain errors

Lab products found in correlation

Trizol reagent, by Thermo Fisher Scientific (2 mentions) Lightcycler 480 sybr green 1 master reagent, by Roche (2 mentions) Lightcycler 480 real time pcr system, by Roche (2 mentions) Rneasy plus mini kit, by Qiagen (1 mentions)

3 protocols using ecodry cdna synthesis kit

Quantitative Real-Time PCR for Cancer Stem Cell Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted with TRIzol reagent (Invitrogen, Carlsbad, CA, USA) following the manufacturer protocol. Five microgram total RNA per sample was used for cDNA synthesis. cDNAs were generated with EcoDry cDNA synthesis Kit (Clontech, San Jose, CA, USA) in a 20 μL reaction volume. Quantitative real time PCR was performed to assess the amplification levels; cancer stem cell (CSC) gene primer pairs (Supplemental Table S2) were designed using Primer3 online tool (https://primer3.ut.ee/ (accessed on 10 October 2012)). All primer pairs included at least one end that recognized the exon-exon-junction to avoid genomic DNA amplification. All PCRs adhered to universal PCR conditions as follows: 2 min at 95 °C, 40 cycles of 5 s at 95 °C and 31 s at 60 °C. Primer pairs are optimized and examined to ensure similar amplification efficiencies prior to PCR assays. Relative gene expression levels were calculated using the delta-delta-Ct approach [24 (link)].

Cheng R.Y., Burkett S., Ambs S., Moody T., Wink D.A, & Ridnour L.A. (2023). Chronic Exposure to Nitric Oxide Induces P53 Mutations and Malignant-like Features in Human Breast Epithelial Cells. Biomolecules, 13(2), 311.

+ Open protocol

+ Expand

Quantification of STAT3 mRNA in B16F10 cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

Transfections of anti-STAT3 and scrambled op-shRNA were performed as described above in B16F10 cells. Total RNA was extracted 48 hours post-transfection, by an RNeasy Plus Mini kit (Qiagen, Hilden, Germany) and then converted to cDNA using an Ecodry cDNA synthesis kit (Clontech, Mountain View, CA, US). The cDNA was amplified with a LightCycler® 480 SYBR Green I Master reagent and quantified by a Roche LightCycler 480 Real-Time PCR System. Primer sequences used for detection were: mouse actin forward: tggcgcttttgactcaggat; mouse actin reverse: gggatgtttgctccaaccaa; mouse STAT3 forward: ggatcgctgaggtacaaccc; mouse STAT3 reverse: gtcaggggtctcgactgtct A common 2^−ΔΔCT method was applied to data with automatic removal of background fluorescence by the qPCR-associated software.

Wu C., Li J., Wang W, & Hammond P.T. (2018). Rationally Designed Polycationic Carriers for Potent Polymeric siRNA-Mediated Gene Silencing. ACS nano, 12(7), 6504-6514.

+ Open protocol

+ Expand

Quantitative Analysis of Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA was extracted by Trizol reagent (Invitrogen) and converted to cDNA via Ecodry cDNA synthesis kit (Clontech). cDNA was amplified in LightCycler® 480 SYBR Green I Master reagent and quantified by Roche LightCycler 480 Real-Time PCR System. Primer sequences used for detection are: Luciferase forward: gaaatgtccgttcggttggc; Luciferase reverse: tccgataaataacgcgccca; GFP forward: ggagcgcaccatcttcttca; GFP reverse: agggtgtcgccctcgaa; human actin forward:tccctggagaagagctacga; human actin reverse: agcactgtgttggcgtacag; mouse actin forward: tggcgcttttgactcaggat; mouse actin reverse: gggatgtttgctccaaccaa.

Li J., Wang W., He Y., Li Y., Yan E.Z., Zhang K., Irvine D.J, & Hammond P.T. (2017). Structurally Programmed Assembly of Translation Initiation Nanoplex for Superior mRNA Delivery. ACS nano, 11(3), 2531-2544.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!