High capacity cdna reverse transcription kit

Total RNA was extracted from cells using InviTrap spin cell RNA Minikit (Stratec Molecular) according to the manufacturer’s instructions. The RNA concentration was measured by NanoDrop 8000 (Thermo Scientific), and cDNA was reverse transcribed from 1000 ng of total RNA using high-capacity cDNA reverse transcription kits (Bio-Rad). The qRT-PCRs were performed using the QuantiFast SYBR Green PCR Kit (QIAGEN) on the 7900HT Fast Real-Time PCR system (Applied Biosystems). Relative mRNA levels were calculated using the 2–ΔΔCt method and normalized to suitable reference genes following cold exposure. Data are expressed as the fold change relative to the mean value of WT cells.

RNA extraction was carried out using Trizol (15596026, Invitrogen). cDNA was then synthesized by High‐Capacity cDNA Reverse Transcription Kits (1725037, Bio‐Rad, Hercules, CA, USA) or Reverse Transcription Kit (4366596, Thermo Fisher Scientific, Waltham, MA, USA). The expression was detected using SYBR Green Mixture (DRR041A, Takara, Dalian, China). Primers were presented below: NNT‐AS1 (F 5′‐ACGTGCAGACAACATCTACCT‐3′; R 5′‐TACAACACCTTCCCGCAT‐3′), miR‐22‐3p (F 5′‐AAGCTGCCAGTTGAAGAACTGTA‐3′; R 5′‐GCTGTCAACGATACGCTACGTAAC‐3′), YAP1 (F 5′‐TAGCCCTGCGTAGCCAGTTA‐3′; R 5′‐TCATGCTTAGTCCACTGTCTGT‐3′), GAPDH (F 5′‐AATGGGCAGCCGTTAGGAAA‐3′; R 5′‐GCGCCCAATACGACCAAATC‐3′), U6 (F 5′‐CTCGCTTCGGCAGCACA‐3′; R 5′‐AACGCTTCACGAATTTGCGT‐3′). GAPDH or U6 was taken as internal control.

RNA isolation was performed using Trizol reagent and used for cDNA synthesis using High-Capacity cDNA Reverse Transcription Kits (Bio-Rad, Hercules, CA, USA) or Reverse Transcription Kit (Thermo Fisher Scientific, Waltham, MA, USA). qPCR was performed with SYBR Green Mixture (Takara, Dalian, China). Relative expression was normalized to GAPDH or U6. Primer sequences were as follows: PSMA3-AS1 Forward, 5ʹ-AACAGACCATCAGAAGAGAACA-3ʹ and reverse, 5ʹ-GAACAGAAACCAGAGCCATACA-3ʹ; GAPDH Forward, 5ʹ-AAGGTGAAGGTCGGAGTCAA-3ʹ and reverse, 5ʹ-GGAAGATGGTGATGGGATTT-3ʹ.

The ArlR knockout and site-directed mutagenesis strains were generated using the protocol described previously (34 (link)). For the quantitative PCR experiments, 500 ul of ArlR knockout and site-directed mutant strains from overnight pre-culture were grown in 50 ml of TSB (17 g/l tryptone, 3 g/l soya peptone, 2.5 g/l d-glucose, 5 g/l NaCl, 2.5 g/l K₂HPO₄, pH 7.3) at 37°C for 12 h. Total RNA was isolated from planktonic cells using a Qiagen RNeasy Mini kit, RNA purity was checked by the Abs260/Abs280 ratio of 2.0 to 2.1. First-strand cDNA synthesis from total RNA was performed with the High-Capacity cDNA Reverse Transcription Kit (Bio-Rad) using 300 ng of total RNA as the template following the manufacturer's instructions. Expression of icaA was determined by two-step real-time PCR using the Power SYBR Green PCR Master Mix (Bio-Rad) and Real-Time PCR System (Bio-Rad). Primers were annealed at 60°C, and the 16S-RNA was used as reference to normalize all data. The specificity of all qRT-PCR primers (Supplementary Table S1) was verified using normal PCR. Fold changes in various icaA transcripts in ArlR knock out and mutant strains in relative to pLi50-ArlR were calculated using the 2^−ΔΔCt formula (35 (link)).