Total RNAs were extracted in Trizol (Life Technologies, Massachusetts, USA). 2 μg of total RNA was reverse transcribed to generate cDNA, using cDNA synthesis kit (TransGene, Beijing, China). Real-time qPCR analysis was performed in triplicates, with GAPDH as internal controls, using SYBR Green qPCR SuperMix and the StepOnePlus (Applied Bio-systems, California, USA) Real-Time Detection System and following the manufacturer’s instructions. The PCR primers were designed using Primer 3, and their specificity was verified using BLAST (NCBI, Maryland, USA). Primers used in this study are as follows: RLIM-f, TGAGAGATAACAATTTGCTAGGC and RLIM-r, GTGGGCCTTCTTTAATTTGC; p21-f, TGTCCGCGAGGATGCGTGTTC and p21-r, GCAGCCCGCCATTAGCGCAT; p15-f, AGATCCCAACGCCCTGAAC and p15-r, CCCATCATCATGACCTGGATT; GAPDH-f, GAGTCAACGGATTTGGTCGT and GAPDH-r, GACAAGCTTCCCGTTCTCAG.
Sybr green qpcr supermix
Manufactured by Thermo Fisher Scientific
Sourced in United States, Germany, China, Japan
The SYBR Green qPCR SuperMix is a ready-to-use solution designed for quantitative real-time PCR (qPCR) applications. It contains the necessary components, including SYBR Green I dye, DNA polymerase, and buffer, to facilitate the detection and quantification of DNA targets.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (66 mentions)
Abi prism 7500 sequence detection system, by Thermo Fisher Scientific (29 mentions)
Trizol, by Thermo Fisher Scientific (22 mentions)
Improm iitm reverse transcription system, by Promega (11 mentions)
Transscript first strand cdna synthesis supermix, by Transgene (10 mentions)
Nanodrop 2000, by Thermo Fisher Scientific (10 mentions)
M mlv reverse transcriptase, by Promega (10 mentions)
Primescript rt reagent kit, by Takara Bio (8 mentions)
Mirneasy mini kit, by Qiagen (7 mentions)
Cfx96 real time pcr detection system, by Bio-Rad (5 mentions)
Biophotometer plus, by Eppendorf (5 mentions)
7500 fast real time pcr system, by Thermo Fisher Scientific (4 mentions)
Nanodrop 2000 ultra micro spectrophotometer, by Thermo Fisher Scientific (4 mentions)
Improm 2 reverse transcription system, by Promega (4 mentions)
Reverse transcription system, by Promega (4 mentions)
Nanodrop 2000 spectrophotometer, by Thermo Fisher Scientific (3 mentions)
High capacity cdna reverse transcription kit, by Thermo Fisher Scientific (3 mentions)
Trizol reagent, by Takara Bio (3 mentions)
Rneasy mini kit, by Qiagen (3 mentions)
Goscript reverse transcription system, by Promega (3 mentions)
172 protocols using sybr green qpcr supermix
1
Gene Expression Analysis by qPCR
2
Effect of MWP on Aβ-induced BV2 Microglia
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
BV2 microglia were treated with Aβ (20 μM) in the absence or the presence of different concentrations of MWP (50, 100, and 200 mg/L) for 6 h. Total RNA was extracted using the RNAprep pure Cell Kit (Tiangen Biotech Co., Ltd, China). Reverse transcription was performed using the TIANScript RT Kit (Tiangen Biotech Co., Ltd, China) to obtain cDNA. Real-time PCR was performed in an ABI7500 real-time PCR instrument (Applied Biosystems) with the SYBR Green qPCR SuperMix, and the transcripts were amplified in a tube containing 1 μg of cDNA and 0.1 μmol of each forward and reverse primer. The PCR amplification procedure was as follows: 95°C for 10 min followed by 40 cycles of 95°C for 30 seconds, 54°C for 30 seconds, 72°C for 60 seconds and a final extension at 95°C for 30 seconds, 55°C for 30 seconds, and 95°C for 30 seconds. Melting curve analysis was carried out after amplification to verify the accuracy of the amplicon.
3
Quantitative Real-Time PCR Analysis of Immune Markers
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from cells using TRIzol reagent according to the manufacturer's instructions (Invitrogen Life Technologies). The concentration and quality of the extracted RNA were measured with a NanoDrop 2000 (Thermo Fisher Scientific, Wilmington, DE, USA). The first-strand cDNA was generated using the TransScript first-strand cDNA synthesis supermix (Transgen, Beijing, China) according to the manufacturer's instructions. Primers designed for PCR were synthesized by Sangon Biotech Co., Ltd. (Shanghai, China) and are shown below. The RT-PCR assay was performed using SYBR green qPCR supermix (Applied Biosystems Life Technologies, Foster City, CA, USA) in an ABI PRISM 7500 sequence detection system (Applied Biosystems Life Technologies). The PCR specific primers were 5′-GAC TTT AAG GGT TAC CTG GGT TG-3′ (forward) and 5′-TCA CAT GCG CCT TGA TGT CTG-3′ (reverse) for IL-10, 5′-GGA CAA GCA GTG ACC ATC AAG-3′ (forward) and 5′-CCC AGA ATT ACC AAG TGA GTC CT-3′ (reverse) for PD-L1, 5′-GGT GAA GGT CGG TGT GAA CG-3′ (forward) and 5′-CTC GCT CCT GGA AGA TGG TG-3′ (reverse) for GADPH. The conditions as shown below: 55°C for 10 min, followed by 40 cycles of 95°C for 30 sec, 55–59°C 30 sec and 72°C for 42 sec. The fold changes of each gene were calculated using the ∆∆Ct (cycle threshold) method, and gene expression levels were normalized by GADPH.
4
Quantitative Analysis of RNA Biomarkers
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from cell or tissue samples by Trizol (Invitrogen™). Exosomal RNA was extracted with a kit (Norgen BioTek, NGB-58000). The first strand cDNA synthesis reaction system was prepared in RNase free PCR tube, and theEasyScript first strand cDNA synthesis Supermix k it is used to reverse transcribe RNA into cDNA. SYBR Green qPCR Supermix and Applied Biosystems® 7500 sequence detection system was used to detect the RNA level. GAPDH was used as the internal reference of XIST, and U6 was used as the internal reference of miRNA. PCR primers were purchased from genscript Biotechnology Co., Ltd. The primer sequences were: XIST forward 5’-ACGCTGCATGTGTCCTTAG-3’ and reverse 5’-GAGCCTCTTATAGCTGTTTG-3’; GAPDH forward 5’-TCAAGAAGGTGGTGAAGCAGG-3’ and reverse 5’-TCAAAGGTGGAGGAGTGGGT-3’; miR-655 forward 5’-TGCGCATAATACATGGTTAACC-3’; miR-374c forward 5’-TGCGCATAATACAACCTGCTAA-3’; miR-5590 forward 5’-TGCGCAATAAAGTTCATGTAT-3’; miR-129-1 forward 5’-TGCGCAAGCCCTTACCCCAAAA-3’; miR-129-2 forward 5’-TGCGCAAGCCCTTACCCCAAA-3’; reverse 5’-CCAGTGCAGGGTCCGAGGTATT-3’;U6 forward 5’-CGCTTCGGCAGCACATATAC-3’ and reverse 5’-AAATATGGAACGCTTCACGA-3’. Relative expression was calculated using the 2−△△CT method.
5
RNA Extraction and qPCR Analysis from Tumor Samples
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Sections (à 50 μm) from each tumor were collected and RNA was extracted using the guanidine thiocyanate/CsCl method and the Purelink RNA Mini kit system (Invitrogen, Life Technologies) as described [26] (link). Total RNA concentration was determined with the NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific), and 2 μg RNA per tumor sample were applied for cDNA synthesis using Superscript II reverse transcriptase and random hexamer primers (both from Invitrogen), resulting in a total volume of 200 μl. For individual quantitative real-time (q)PCR, 5 μl of cDNA was amplified in a total volume of 25 μl using the SYBR Green™qPCR SuperMix (Applied Biosystems, Life Technologies) and the Thermocycler CFX 96 touch (Bio-Rad). Relative levels of target mRNAs were calculated using the comparative CT method [27] (link) and normalized to the expression of glyceraldehyde 3-phosphate dehydrogenase (GAPDH). The primers are listed in “Supplementary Methods”.
6
Quantitative RNA Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from tissues and cells using a miRNeasy Mini Kit (Qiagen, Valencia, CA, U.S.A.) in accordance with the manufacturer’s instructions, immediately the concentration and quality of RNA were detected by NanoDrop 2000 (Thermo Fisher, Wilmington, DE, U.S.A.). Then, the obtained RNA was used to synthesize the first-strand complementary DNA (cDNA), using TransScript first-strand cDNA synthesis SuperMix (TransGen, Beijing, China) as per the manufaturer’s protocol. RT-PCR experiment was performed with SYBR green qPCR SuperMix (Applied Biosystems Life Technologies, Foster, CA, U.S.A.) in ABI prism 7500 sequence detection system (Applied Biosystems Life Technologies, Foster, CA, U.S.A.). Experimental conditions were as below: 55°C for 10 min, 40 cycles of 95°C for 30 s, 55–59°C for 30 s, and 72°C for 42 s. Cycle threshold (Ct) values were detected and used to calculate the relative expression levels of DANCR and miR-216a according to 2−ΔΔCT method. GADPH and U6 were respectively as loading control of DANCR and miR-216a.
7
Gene Expression Analysis Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was isolated using PerfectPure RNA Cultured Cell Kit-50 (5 PRIME). One microgram of total RNA was used for reverse transcription reaction using ImProm-II reverse transcriptase (Promega). For sequencing and quantitative experiments, PCRs were performed with ReadyMix (Sigma); for overexpression experiments, PCR reactions used Herculase II Fusion DNA polymerase (Agilent Technologies). Quantitative real-time PCR was performed with 1 μg of RNA reverse transcribed to cDNA and TaqMan Universal Master Mix or SYBR Green qPCR Supermix (see the primer list in Table 1 ; Applied Biosystems) and analyzed with the 7300 real-time PCR system (Applied Biosystems).
8
Quantitative Analysis of miR-190b-5p and EMT Markers
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The miR-190b-5p quantitative real-time PCR assays were performed using TaqMan® MicroRNA Assays (Applied Biosystems, USA), and U6 snRNA (Applied Biosystems, USA) was used as an internal control. For the TUSC8, MYLIP and EMT related markers quantitative real-time PCR assays, GAPDH was used as an internal control. RT-PCR assays were performed by SYBR green qPCR SuperMix (Applied Biosystems Life Technologies, Foster, CA, USA) in ABI prism 7500 sequence detection system (Applied Biosystems Life Technologies). The relative gene expression levels were calculated using the 2-△△Ct method.
9
Total RNA Extraction and qPCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The miRNeasy Mini kit (Qiagen, Valencia, USA) was used to extract total RNA from tissues and cells in accordance with the manufacturer's instructions. The concentration and quality of the RNAs were determined by NanoDrop 2000 (Thermo Fisher, Wilmington, USA). The first-strand cDNA was synthesized by TransScript first-strand cDNA synthesis supermix (Transgen, Beijing, China) in accordance with the manufacturer's instructions. RT-qPCR assay was performed using the SYBR green qPCR supermix (Applied Biosystems Life Technologies, Foster, USA) in ABI prism 7500 sequence detection system (Applied Biosystems Life Technologies, Foster, USA). Conditions of the PCR reactions were presented as below: 55 °C for 10 min, 40 cycles of 95 °C for 30 s, 55-59 °C 30 s and 72 °C for 42 s. Fold changes of the target genes was calculated by 2-ΔΔCt methods (cycle threshold), and expression levels of miRNA and lncRNA/target gene were normalized by U6 and GADPH, respectively.
10
Gene Expression Analysis from Total RNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA from tissues and cells was isolated using the miRNeasy Mini Kit (Qiagen, Valencia, CA, USA). Its concentration was assessed by NanoDrop 2000 (Thermo Fisher; Wilmington, DE, USA). Total RNA samples were reverse transcribed using TransScript First-Strand cDNA Synthesis SuperMix (TransGen; Beijing, China). Real-time PCR reactions were performed using SYBR Green qPCR SuperMix (Applied Biosystems Life Technologies; Foster, CA, USA) under ABI Prism 7900 sequence detection system (Applied Biosystems Life Technologies). The primers used in this study have been described previously [11 (link), 13 (link)]. The expression was quantified using the 2−ΔΔCt method, and U6 and GADPH were used as internal controls.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!