Mir 129 5p mimic

HEK293T cell lines were co-transfected with miR-129-5p mimic or NC mimic (RiboBio, Guangzhou, China) and reporter plasmids containing the wild-type (WT) or mutant (MUT) circTADA2A, TRPS1 and YAP1 promoters (GeneChem), respectively. Luciferase reporter assay was performed using Dual-Luciferase Reporter Assay System (Promega, USA). For comparisons, firefly luciferase activity was normalized to Renilla luciferase activity. The effect of a miR-129-5p on the luciferase reporter with the circTADA2A 3′-UTR, TRPS1 3′-UTR, YAP1 3′-UTR or the corresponding mutant was calculated by comparing the reporter with the control. Each luciferase reporter assay was conducted in triple replicates.

MiR-NC mimics, miR-129-5p mimics, miR-NC antagonist, and miR-129-5p antagonist were bought from RiboBio (Guangzhou, P.R. China). For miR-129-5p overexpression or downregulation, miR-129-5p mimics or miR-129-5p antagonist was mixed with Lipofectamine 2000 (Invitrogen, Thermo Fisher Scientific), maintained for 15 minutes, and then added into culture medium of cells. Seventy-two hours after transfection, the cells were harvested and the RNA and/or protein was extracted for the following experiments.

Wild-type (WT) or mutant (MUT) versions of miR-129-5p were subcloned into the pGL3 Basic vector (Promega Corporation). A total of 20 nM miR-129-5p mimics (5'CUUUUUGCGUCUGGGCUUGC3') (Guangzhou RiboBio Co., Ltd.) were co-transfected with pLUC-WT-HMGB1 (5'UACCACUCUGUAAUUGCAAAAAA) or pLUC-MUT-HMGB1 (5'UACCACUCUGUAAUUCCUAUAUA) (500 ng) into 3x10⁴ A7r5 cells. Cells were transfected using Lipofectamine^® 2000 (Invitrogen; Thermo Fisher Scientific, Inc.) according to the manufacturer's protocol. After 48 h incubation at 37˚C, the cells were lysed by lysis buffer as supplied by the Dual-Luciferase Detection kit (Beyotime Institute of Biotechnology) on ice and luciferase activity was tested using the Dual-Luciferase Reporter assay system (Promega Corporation). Luciferase activity was normalized to Renilla luciferase activity. After transfection for 48 h, relative luminescence was tested using luminometry according to the manufacturer's instructions.

The specific short hairpin RNA (shRNA) directed against human lncRNA LINC00501 was cloned into pENTR TM/U6 plasmid (GenePharma, Shanghai, China) and called sh-LINC00501, and non-targeted shRNA (sh-NC, GenePharma) was adopted as negative control.MiR-129-5p mimics (miR-129-5p-mimics), inhibitors (miR-129-5p-inhibit), and their respective controls (miR-NC) were all processed by RiboBio (Guangzhou, China). For overexpression of HMGB1, the full-length HMGB1 sequence was transfected into pcDNA vector (ThermoFisher, China), called pcDNA-LINC00501, and pcDNA-3.1 was adopted as blank control. Transfection operations were all carried out with Lipofectamine 3000 reagent (Life Technologies Corp., Carlsbad, United State) under the manufacturer’s instruction. Stable transfected H1299 and A549 cells were collected, and cultured in medium containing 0.5 mg/mL G418 (Sigma-Aldrich, st Louis, Missouri, Untied States), and stable transfected cells were adopted for later analyses.