Taqman fast universal master mix

Manufactured by Thermo Fisher Scientific

Sourced in United States

TaqMan Fast Universal Master Mix is a pre-formulated reagent for real-time PCR applications. It contains all the necessary components, including DNA polymerase, dNTPs, and buffer, to perform rapid and efficient real-time PCR reactions.

Automatically generated - may contain errors

Lab products found in correlation

Spelling variants of this product

TaqMan Master Mix (448 citations) Universal Master Mix (122 citations) Taqman universal mix (6 citations) Fast Taqman mix (4 citations)

72 protocols using taqman fast universal master mix

Transcriptome Analysis of Sorted Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA from sorted cells was extracted using QIAshredder columns (QIAGEN, Mansfield, MA, Cat no.: 79656) and the RNeasy Plus Mini Kit (QIAGEN, Cat no.: 74136) according to the manufacturer’s instructions. Purified RNA was eluted in either 14 or 30 μl nuclease-free water, quantified on a NanoDrop ND-1000 microvolume spectrophotometer (ThermoFisher Scientific, Waltham, MA), and diluted as needed. cDNA was prepared using Taqman Reverse Transcription Reagents (Applied Biosystems, Waltham, MA, Cat no.: N808-0234). cDNA samples were prepared with TaqMan Fast Universal Master Mix (Life Technologies, 4367846) and diluted to 6.25 ng per 25 μl reaction for real-time analysis on the StepOnePlus Real Time PCR System (Applied Biosystems). Relative expression analysis calculations were performed according to the ΔΔCt method^{63 (link)} utilizing 18S rRNA as the internal reference gene and either presort cells or whole embryo cells as the reference sample. If expression was undetected based on the set threshold, the value was set to the maximum number of cycles (40) to allow fold change calculations. The data were graphed for visualization as shown in the figures using the GraphPad Prism 8 (version 8.0.2) software.
TaqMan gene expression arrays were purchased from Applied Biosystems and are listed in Supplementary Table 1.

Ikonomou L., Herriges M.J., Lewandowski S.L., Marsland R I.I.I., Villacorta-Martin C., Caballero I.S., Frank D.B., Sanghrajka R.M., Dame K., Kańduła M.M., Hicks-Berthet J., Lawton M.L., Christodoulou C., Fabian A.J., Kolaczyk E., Varelas X., Morrisey E.E., Shannon J.M., Mehta P, & Kotton D.N. (2020). The in vivo genetic program of murine primordial lung epithelial progenitors. Nature Communications, 11, 635.

+ Open protocol

+ Expand

Quantification of miR-155 Expression Using RT-qPCR

Check if the same lab product or an alternative is used in the 5 most similar protocols

Cells were collected, resuspended in RNAlater (Ambion AM7020), and stored at −20°C for further RNA isolation. Subsequently, RNA was purified in 40 μL H₂O using the mirVana (Ambion AM1561) kit and following the manufacturer’s instructions. miR-specific RT was performed on 5 μL of the extracted RNA and using TaqMan primer pairs (TaqMan SnoRNA202 1232, TaqMan mmu-miR155 2571) and the TaqMan RT kit (Life Technologies 4366597) following the manufacturer’s instructions. Finally, qPCR was run using 96-well optical plates (Life Technologies 4346906) in a 7500 Fast Real-Time PCR machine (Thermo Fisher Scientific 4351106). The qPCR mix volume was of 10 μL/well and comprised 2 μL of the RT reaction mixed with the primers and TaqMan Fast Universal Master Mix (Life Technologies 4352042). All qPCR reactions were performed in 2 technical replicates, and the values were excluded if the difference in cycle threshold (C_T) was higher than 0.2 or if one of the C_T values was higher than 33. The mean of the technical replicates of the control gene (snoRNA202) was substracted to the mean of the technical replicates of the gene of interest (miR-155) to calculate the ΔC_T. Fold changes in expression were then calculated using a control sample for normalization as such:

F o l d c h a n g e o f m i R 155 e x p r e s s i o n i n (x) = 2^{Δ C t (c o n t r o l s a m p l e) - Δ C t (s a m p l e x)} .

Monnot G.C., Martinez-Usatorre A., Lanitis E., Lopes S.F., Cheng W.C., Ho P.C., Irving M., Coukos G., Donda A, & Romero P. (2019). miR-155 Overexpression in OT-1 CD8+ T Cells Improves Anti-Tumor Activity against Low-Affinity Tumor Antigen. Molecular Therapy Oncolytics, 16, 111-123.

+ Open protocol

+ Expand

RNA Isolation and Real-Time PCR Analysis

Cited 2 times

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA was isolated using the RNeasy Plus Mini Kit (QIAGEN) and reverse transcribed with the High Capacity cDNA Transcription Kit (Life Technologies). Real-time PCR was performed using fluorogenic probe/primer combinations (Supplementary Table 7) specific for the target gene and TaqMan FAST Universal master mix (Life Technologies). All mRNA levels were normalized to levels of mouse Gapdh mRNA determined with the TaqMan Rodent GAPDH Control Kit or human GAPDH mRNA with primers for GAPDH nucleotides 37-910 or OAZ1 mRNA using the IDT PrimeTime Pre-designed assay Hs.PT.42.328511.g from Integrated DNA Technologies (Coralville, IA) ^{47 (link)}.
Oligonucleotide microarray analysis was performed as described previously ^{48 (link)}. Gene expression analysis was performed using Illumina Mouse-WG6 v1.1 BeadChips for mouse samples, and Illumina HumanHT-12 v3 BeadChips for human samples (Illumina, San Diego, CA, USA). Isolated total RNA was amplified and biotinylated using the Ambion Illumina TotalPrep Kit. Hybridization and scanning of BeadChip arrays was performed according to the manufacturer’s instructions, using BeadStudio 3.0 software (Illumina). Treatment and conditions were randomized across BeadChip slides to avoid confounding. In order to perform bead-level analysis, raw data was exported from BeadStudio.

Zhang Y., Mao D., Roswit W.T., Jin X., Patel A.C., Patel D.A., Agapov E., Wang Z., Tidwell R.M., Atkinson J.J., Huang G., McCarthy R., Yu J., Yun N.E., Paessler S., Lawson T.G., Omattage N.S., Brett T.J, & Holtzman M.J. (2015). PARP9-DTX3L ubiquitin ligase targets host histone H2BJ and viral 3C protease to enhance interferon signaling and control viral infection. Nature Immunology, 16(12), 1215-1227.

+ Open protocol

+ Expand

Quantitative RT-qPCR Protocol for Gene Expression

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

RT and qPCR were performed as described in our previous studies [12 (link), 13 (link)]. A total of 100 ng RNA was reverse transcribed using the high-capacity complementary DNA (cDNA) archive kit (Life Technologies). For qPCR, 5 ng cDNA was mixed with TaqMan Fast Universal Master Mix (Life Technologies) following the manufacturer’s recommendations. qPCR was performed using the StepOne Plus Fast Real-Time PCR system (Applied Biosystems). The primer-probe sets for CYP11B2 were designed in house and purchased from Integrated DNA Technologies [19 (link), 20 (link)]. The primer-probe sets for β-actin (ACTB), VSNL1, and CLCN2 were purchased from Life Technologies and those for CYP11B2, CYP11B1, and CYP17A1 were designed in house [20 (link)]. Quantitative normalization of cDNA in each tissue-derived sample was performed using the expression of ACTB as an internal control. Relative quantification was determined using the comparative threshold cycle method.

Rege J., Nanba K., Blinder A.R., Plaska S., Udager A.M., Vats P., Kumar-Sinha C., Giordano T.J., Rainey W.E, & Else T. (2020). Identification of Somatic Mutations in CLCN2 in Aldosterone-Producing Adenomas. Journal of the Endocrine Society, 4(10), bvaa123.

+ Open protocol

+ Expand

Quantitative PCR Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA was isolated using TRIzol (Life Technologies) as per the manufacturer’s protocol. One microgram of RNA was reverse transcribed using iScript cDNA synthesis kit (Bio-Rad, Hercules, CA). Gene-specific primers were used along with TaqMan Fast Universal master mix (Life Technologies), and respective mRNA levels were assessed using quantitative PCR (ViiA 7, Applied Biosystems). All genes were normalized to β-actin. Primers used were: Per2 (Hs 00256144), CTGF (Hs 00170014), β-catenin (CTNNB1 Hs 00355049), and β-actin (Hs 01060665) from Applied Biosystems.

Jadhav V., Luo Q., M. Dominguez J 2.n.d., Al-Sabah J., Chaqour B., Grant M.B, & Bhatwadekar A.D. (2016). Per2-Mediated Vascular Dysfunction Is Caused by the Upregulation of the Connective Tissue Growth Factor (CTGF). PLoS ONE, 11(9), e0163367.

+ Open protocol

+ Expand

Survivin and MAPK1 Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

First-strand cDNA was synthesized using the DyNAmo cDNA Synthesis Kit (Thermo Fisher Scientific, Waltham, USA). The mRNA transcripts were detected using PrimeTime qPCR assays (Integrated DNA Technologies, IDT, Leuven, Belgium). Sequence-specific primers and fluorescence-labeled probes complementary to a sequence present in all survivin splice variants (Hs.PT.56a.1608989.g), survivin-2B (Hs.PT.56a.3536061), survivin-Δex3 (Hs.PT.56a.21530439), MAPK1 (Hs.PT.58.39782850), and the endogenous controls GAPDH (Hs.PT.39a.22214836) and HPRT1 (Hs.PT.58.20881146) were used. Real-time PCRs were performed in triplicate in a final volume of 10 μl containing 1× TaqMan Fast Universal master mix (Life Technologies) and 1xPrimeTime assay. The relative RNA expression levels were calculated by applying the ΔΔCt method [59 (link)].

Nolte E., Wach S., Silva I.T., Lukat S., Ekici A.B., Munkert J., Müller-Uri F., Kreis W., Simões C.M., Vera J., Wullich B., Taubert H, & Lai X. (2017). A new semisynthetic cardenolide analog 3β-[2-(1-amantadine)- 1-on-ethylamine]-digitoxigenin (AMANTADIG) affects G2/M cell cycle arrest and miRNA expression profiles and enhances proapoptotic survivin-2B expression in renal cell carcinoma cell lines. Oncotarget, 8(7), 11676-11691.

+ Open protocol

+ Expand

Quantitative Gene Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

The same number of HuDe and T84 cells were lysed by adding RLT PLUS buffer (QIAGEN) for RNA extraction using a QIA Symphony RNA Kit (QIAGEN). RNA purification was performed according to the manufacturer's instructions. The RNA was reverse transcribed using iScript™ cDNA Synthesis Kit (BIO-RAD). The cDNA was used as a template for quantitative PCR (qPCR) performed with TAQMAN^®; Fast Universal Master Mix (Life Technologies). Estimation of the change in gene expression was made using the ΔΔCT method. The following TaqMan gene expression assays were used: GAPDH (Hs02786624_g1), Tubulin (Hs00742828_s1), Actin (Hs01060665_g1), HPRT1 (Hs02800695_m1),ClC-2 (Hs00189078_m1). Raw data were normalized with respect to expression values of the housekeeping genes GAPDH, HPRT-1, Actin and Tubulin. Results were analyzed using Graph Pad PRISM 6.0.

Sardi C., Garetto S., Capone L., Galbiati V., Racchi M., Govoni S., Giovagnoni E, & Lucci J. (2018). Experimental Paradigm for the Assessment of the Non-pharmacological Mechanism of Action in Medical Device Classification: The Example of Glycerine as Laxative. Frontiers in Pharmacology, 9, 1410.

+ Open protocol

+ Expand

RNA Expression Analysis by qPCR and Microarray

Cited 2 times

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA was isolated using the RNeasy Plus Mini Kit (QIAGEN) and was reverse-transcribed with a High Capacity cDNA Transcription Kit (Life Technologies). Real-time PCR was performed using fluorogenic probe-primer combinations (Supplementary Table 7) specific for the target gene and TaqMan FAST Universal master mix (Life Technologies). All mRNA levels were normalized to levels of the control gene mouse Gapdh mRNA, determined with the TaqMan Rodent GAPDH Control Kit or human GAPDH mRNA with primers for GAPDH nucleotides 37–910 or OAZ1 mRNA with the IDT PrimeTime Pre-designed assay Hs.PT.42.328511.g from Integrated DNA Technologies^{47 (link)}.
Oligonucleotide microarray analysis was performed as described^{48 (link)}. Gene-expression analysis was performed using Illumina Mouse-WG6 v1.1 BeadChips for mouse samples, and Illumina HumanHT-12 v3 BeadChips for human samples (Illumina). Isolated total RNA was amplified and biotinylated with an Ambion Illumina TotalPrep Kit. Hybridization and scanning of BeadChip arrays was performed according to the manufacturer's instructions, with BeadStudio 3.0 software (Illumina). Treatment and conditions were randomized across BeadChip slides to avoid confounding. For bead-level analysis, raw data were exported from BeadStudio.

+ Open protocol

+ Expand

RNA isolation, cDNA synthesis, and RT-PCR

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA was isolated using the Purelink RNA Mini kit from Life Technologies (Carlsbad, CA) according to the manufacturer’s protocol. The RNA was then reverse transcribed to cDNA using the High-Capacity cDNA Reverse Transcription kit from Applied Biosystems (Grand Island, NY) according to the manufacturer’s protocol. The RT-PCR was performed using Taqman gene-specific probes (Applied Biosystems) with Taqman Fast Universal Master Mix (Life Technologies) according to the published protocol using the Viia7 RT-PCR machine (Applied Biosystems). The GAPDH RNA expression was used to normalize the WIF1 levels.

Reno T.A., Tong S.W., Wu J., Fidler J.M., Nelson R., Kim J.Y, & Raz D.J. (2016). The triptolide derivative MRx102 inhibits Wnt pathway activation and has potent anti-tumor effects in lung cancer. BMC Cancer, 16, 439.

+ Open protocol

+ Expand

Gene Expression Analysis by qPCR

Check if the same lab product or an alternative is used in the 5 most similar protocols

We isolated total RNA with the RNeasy kit (74136; QIAGEN, Hilden, Germany) and made complementary DNA (cDNA) from 5 µg of total RNA with SuperScript III (12574026; Invitrogen) and oligo-dT primers. We performed qPCR with TaqMan Fast Universal Master Mix (4352042; Applied Biosystems, Waltham, Massachusetts, USA) and TaqMan probes (Applied Biosystems) or the Universal Probe Library (UPL, Roche) system. We conducted three technical replicates. We applied GAPDH (4352934T; Applied Biosystems) as an endogenous control to normalize expression. The information of primers and probes are as below; TFCP2L1 (TaqMan probe: Hs00232708_m1), KLF4 (TaqMan probe: Hs00358836_m1), and STELLA (UPL: #80, primer: U_STELLA R tggtagcaatttgaggctctg, U_STELLA L atcggcgtcttgacacaac).

Ozaki H., Suga H., Sakakibara M., Soen M., Miyake N., Miwata T., Taga S., Nagai T., Kano M., Mitsumoto K., Miyata T., Kobayashi T., Sugiyama M., Onoue T., Takagi H., Hagiwara D., Iwama S., Banno R., Iguchi G., Takahashi Y., Muguruma K., Inoue H, & Arima H. (2022). Differentiation of human induced pluripotent stem cells into hypothalamic vasopressin neurons with minimal exogenous signals and partial conversion to the naive state. Scientific Reports, 12, 17381.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!