The optimal concentrations for inhibition of macropinocytosis in cultured cells have been determined previously to be 40 μM for EIPA and 2.5 μM for IPA-3 (Commisso et al., 2013 (link)), and were the concentrations used here. GSK3 inhibition was performed with 40 mM LiCl or 40 mM NaCl as a control and with 8 nM CHIR99021 using DMSO added at matched volumes as a control. Wnt3a and control buffer were also used for 20 min incubation periods or less. Wnt3a protein was purchased from PeproTech (Cat# 315–20) and used at 100 ng/mL. For cycloheximide experiments, 20 μg/mL cycloheximide was added to cells 4 hours prior to GSK3 inhibition or Wnt3a addition. In order to inhibit any possible endogenous Wnt signals, the Porcupine inhibitor IWP-2 (2 μM) was added to the culture medium in these studies for 12 hours prior to each experiment as described (Colozza et al., 2020 (link)).
Wnt3a protein
Manufactured by Thermo Fisher Scientific
Wnt3a protein is a signaling molecule that plays a crucial role in various cellular processes. It is a member of the Wnt protein family, which are secreted glycoproteins involved in cell-to-cell signaling. The Wnt3a protein is known for its ability to activate the Wnt/β-catenin signaling pathway, which is important in embryonic development, cell fate determination, and tissue homeostasis.
Automatically generated - may contain errors
Lab products found in correlation
Ab150117, by Abcam (2 mentions)
Ab52939, by Abcam (2 mentions)
Ab131522, by Abcam (2 mentions)
Ab150083, by Abcam (2 mentions)
Total β catenin antibody, by Thermo Fisher Scientific (2 mentions)
Dynabeads m 270 carboxylic acid, by Thermo Fisher Scientific (1 mentions)
Edc nhs, by Merck Group (1 mentions)
Interleukin 2 (il 2), by Thermo Fisher Scientific (1 mentions)
Tws119, by Selleck Chemicals (1 mentions)
Complete freund s adjuvant cfa, by Merck Group (1 mentions)
Ovalbumin (ova), by Merck Group (1 mentions)
Anti cd3, by BD (1 mentions)
Anti cd28, by BD (1 mentions)
Cq diphosphate, by Merck Group (1 mentions)
Anti atp6v0a3 antibody, by Novus Biologicals (1 mentions)
Sir lysosome, by Cytoskeleton (1 mentions)
Ipa 3, by Merck Group (1 mentions)
Glyceraldehyde 3 phosphate dehydrogenase antibody, by Cell Signaling Technology (1 mentions)
Concanamycin a, by Merck Group (1 mentions)
Gapdh, by Cell Signaling Technology (1 mentions)
6 protocols using wnt3a protein
1
Macropinocytosis Inhibition and Wnt Signaling
2
Immobilizing Wnt3a Protein on Dynabeads
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Wnt3a was immobilized onto Dynabeads as described previously39 (link). Briefly, 2.8 μm Dynabeads M-270 Carboxylic Acid (Invitrogen) were activated by NHS/EDC (Sigma, 50 mg/ml each in cold 25 mM MES pH 5) then washed three times with cold MES buffer. Wnt immobilization was performed by diluting 0.5 μg of purified Wnt3a protein (Peprotech, #315-20) in cold MES buffer and incubated at room temperature (RT) for 1 hr. To quench non-reactive carboxylic acid groups, beads were incubated with 50 mM Tris pH 7.4 at RT for 15 min. Beads were washed twice in PBS pH 7.4 before final resuspension in 400 μl PBS/0.5% BSA and stored at 4 °C. Unloaded-beads were prepared in parallel by incubating 1 hr in MES without Wnt. Wnt3a activity following bead immobilization was verified using a TOPflash luciferase reporter assay53 (link).
3
Macropinocytosis Inhibition and Wnt Signaling
4
Generation of T Stem Cell Memory Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The CD44lowCD62Lhigh cells were stimulated with 2 μg/mL anti-CD3 (BD Pharmingen), 1 μg/mL anti-CD28 (BD Pharmingen), and 10 ng/mL IL-2 (Peprotech, Rocky Hill, NJ) in the presence of TWS119 (7 μM) (Selleckchem, Houston, TX) or Wnt3A protein (1 μg/mL) (Peprotech) in vitro. For generation of TSCMs in vivo, 2×106 OT-I naive CD8+ T cells were adoptively transferred into congenic CD45.1 mice and then injected intraperitoneally (500 μg) per mouse OVA (Sigma-Aldrich) with complete Freund’s adjuvant (CFA) (Sigma). Mice received 4 doses per day of TWS119 at 40 mg/kg from day 0 to day 3. Six days after injection, mice with or without the treatment of TWS119 were sacrificed for further analysis. The CD8+ TSCMs were isolated by flow cytometry on the basis of the expression of surface markers (CD3+ CD4− CD8+ CD62L+ CD44− CD122+ Sca-1+ T cells for in vitro-generated TSCMs or CD45.1+ CD8+ CD62L+ CD44−CD122+ Sca-1+ T cells for in vivo-generated TSCMs).
5
Lysosome-targeting Reagents in Cell Signaling
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
SiR-Lysosome was purchased from Cytoskeleton (CYSC012, used at 1 μM).
HCQ (H0915), CQ diphosphate (C 6628), EIPA (A3085), LiCl and sodium chloride (NaCl) (S9888), IPA-3 (I2285, used at 2.5 μM), and Concanamycin A (C9705, used at 5 μM) were obtained from Sigma. Baf (S1413) was purchased from Selleckchem. TMR-dextran 70,000 kDa was purchased from ThermoFisher (D1818). Total β-catenin antibody (1:1,000) was purchased from Invitrogen (712700), glyceraldehyde-3-phosphate dehydrogenase antibody (1:1,000) was obtained from cell signaling, anti-ATP6V0a3 antibody (23 (link)) was obtained from Novus (nbp1-89333, 1:1,000). Antibodies against Pak1 (ab131522) and Ras (ab52939) and secondary antibodies for immunostaining (ab150083, ab150117) (1:500) were obtained from Abcam. Wnt3a protein was from Peprotech (315-20) and used at 100 ng/mL. Hrs-MO TGCCGCTTCCTCTTCCCATTGCGAA (9 (link)) was from Gene Tools and microinjected as 4 nL of 0.3 mM MO.
HCQ (H0915), CQ diphosphate (C 6628), EIPA (A3085), LiCl and sodium chloride (NaCl) (S9888), IPA-3 (I2285, used at 2.5 μM), and Concanamycin A (C9705, used at 5 μM) were obtained from Sigma. Baf (S1413) was purchased from Selleckchem. TMR-dextran 70,000 kDa was purchased from ThermoFisher (D1818). Total β-catenin antibody (1:1,000) was purchased from Invitrogen (712700), glyceraldehyde-3-phosphate dehydrogenase antibody (1:1,000) was obtained from cell signaling, anti-ATP6V0a3 antibody (23 (link)) was obtained from Novus (nbp1-89333, 1:1,000). Antibodies against Pak1 (ab131522) and Ras (ab52939) and secondary antibodies for immunostaining (ab150083, ab150117) (1:500) were obtained from Abcam. Wnt3a protein was from Peprotech (315-20) and used at 100 ng/mL. Hrs-MO TGCCGCTTCCTCTTCCCATTGCGAA (9 (link)) was from Gene Tools and microinjected as 4 nL of 0.3 mM MO.
6
Wnt Signaling Pathway Regulation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Reagents and Antibodies. SiR-Lysosome was purchased from Cytoskeleton (CYSC012, used at 1 μM). Tetramethylrhodamine Dextran (TMR-Dx) 70,000 kDa was purchased from ThermoFisher (D1818).
Total β-catenin antibody (1:1000) was purchased from Invitrogen (712700), GAPDH (1:1000) was obtained from cell signaling, anti-ATP6V0a3 antibody (23) was obtained from Novus (nbp1-89333 1:1000). Antibodies against Pak1 (ab131522), Ras (ab52939), and secondary antibodies for immunostaining (ab150083, ab150117) (1:500) were obtained from Abcam. Wnt3a protein was from Peprotech (315-20) and used at 100 ng/ml. HRS-MO TGCCGCTTCCTCTTCCCATTGCGAA (9) was from Gene Tools and microinjected as 4 nl of 0.3 mM MO. Tissue Culture. HEK-293BR (BAR/Renilla) were cultured in DMEM containing 10% fetal bovine serum (FBS), SW480 cells and SW480APC cells (31) were cultured at 37 ° C in 5% CO2 atmosphere in DMEM/F12 (Dulbecco's Modified Eagle Medium: Nutrient Mixture F-12), supplemented with 5% fetal bovine serum, 1% glutamine, and penicillin/streptomycin. The cells were seeded at a cell density of 20%-30% and experiments were performed when cells reached a confluence of 70-80%. Cells were cultured 6-8 hours in medium with 2% fetal bovine serum before treatments.
Total β-catenin antibody (1:1000) was purchased from Invitrogen (712700), GAPDH (1:1000) was obtained from cell signaling, anti-ATP6V0a3 antibody (23) was obtained from Novus (nbp1-89333 1:1000). Antibodies against Pak1 (ab131522), Ras (ab52939), and secondary antibodies for immunostaining (ab150083, ab150117) (1:500) were obtained from Abcam. Wnt3a protein was from Peprotech (315-20) and used at 100 ng/ml. HRS-MO TGCCGCTTCCTCTTCCCATTGCGAA (9) was from Gene Tools and microinjected as 4 nl of 0.3 mM MO. Tissue Culture. HEK-293BR (BAR/Renilla) were cultured in DMEM containing 10% fetal bovine serum (FBS), SW480 cells and SW480APC cells (31) were cultured at 37 ° C in 5% CO2 atmosphere in DMEM/F12 (Dulbecco's Modified Eagle Medium: Nutrient Mixture F-12), supplemented with 5% fetal bovine serum, 1% glutamine, and penicillin/streptomycin. The cells were seeded at a cell density of 20%-30% and experiments were performed when cells reached a confluence of 70-80%. Cells were cultured 6-8 hours in medium with 2% fetal bovine serum before treatments.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!