Light cycler 480 software 1

The sequences of BCR-ABL1 genomic junctions (Table 1) were used to design a pair of specific primers for each patient (see Supplementary Table 1) using the Primer3Plus tool (http://www.bioinformatics.nl/cgi-bin/primer3plus/primer3plus.cgi). The primer forward maps at the 5′ and the primer reverse maps at the 3′ of the breakpoint site (60–200 bp product length). Before ddPCR analysis, a qualitative PCR was performed for each pair of primers to verify their specificity, using the Platinum Taq DNA Polymerase (Thermo Fisher Scientific), 200 ng of genomic DNA, in a final volume of 50 μl (thermal-cycling conditions: 95° C for 5 min, 95° C for 30 s, 60° C for 20 s, 72° C for 20 s (35 cycles), 72° C for 8 min and 4° C hold). Each pair of primers was tested on the specific patient, on a NC (a CML patient with a different breakpoint) and a NTC. The PCR products were visualized on an 1.5% agarose-gel. Furthermore, a melting curve assay was performed by qRT-PCR experiments with the LightCycler 480 SYBR Green I Master mix on the LightCycler 480II (Roche Diagnostics, Indianapolis, IN). Amplification thermal protocol: 95° C for 10 min, 95° C for 10 s, 60° C for 30 s, and 72° C for 1 min (45 cycles). The analysis was performed using the LightCycler 480 Software 1.5.1 (Roche Diagnostics).

To validate a systematic immune response to AS challenge, we performed qPCR analyses on first-strand cDNA synthesized from total RNA of head kidney samples matched to the same fish used in proteomics (n = 6 control, n = 6 AS). RNA extraction and cDNA synthesis were done as detailed elsewhere [111 (link)]. qPCR was performed on a Roche LightCycler® 480 using 2× SYBR® Green I (Invitrogen™) qPCR Master Mix, made with a Immolase DNA Polymerase kit (Bioline), using 10 μL reaction mixtures in 384-well plates (Roche), containing 4 μL diluted cDNA in each reaction and 500 nmol of forward and reverse primers (primer details for IL-1β, TNF-a2 and EF-1α published in Hu et al. [112 (link)]). Raw data were analyzed using LightCycler® 480 Software 1.5.1 (Roche). The copy number of each gene was quantified using internal references, by serial dilution of equimolar amounts of PCR product from each gene. Relative gene expression values were separately calculated by normalizing copy number values for IL-1β and TNF-a2 against EF-1α (i.e. reference gene) values. To test for differences between the AS and control samples, a one-way ANOVA was completed in Minitab 18 (Minitab, Inc). As the model residuals either showed non-normality or unequal variances for both target genes, a Box-Cox transformation was performed, leading to data that conformed to the assumptions of normality and equal variances.

mRNA expression of genes encoding endothelin receptor type A (Ednra) and type B (Ednrb) was analyzed in mouse thoracic aorta by Quantitative Real-Time PCR (qPCR). RNA was isolated using MagNA Pure LC RNA Isolation Kit High Performance (Roche), and reverse transcribed using AMV First Strand cDNA Synthesis Kit for reverse transcription (RT)-PCR (Roche). qPCR was performed on a LightCycler 480 system (Roche) according to the manufacturer’s protocol with reaction mixtures containing 2.5 μl cDNA, 0.4 μmol/L of each primer (Life Technologies), 100 nmol/L UPL probe (Roche) and 10 μl Absolute qPCR mix (Thermo Scientific) in a total volume of 20 μl. Primer (shown in 5′ → 3′orientation)/probes were designed using the Roche Universal Probe Library Assay Design Center:
mEdnra GGGCATCACCGTCTTGAA/GGAAGCCACTGCTCTGTACC, probe UPL#99, mEdnrb TCAGAAAACAGCCTTCATGC/GCGGCAAGCAGAAGTAGAA, probe UPL#83, mHprt TGATAGATCCATTCCTATGACTGTAGA/AAGACATTCTTTCCAGTTAAAGTTGAG, probe UPL#22. QPCR data were analyzed and quantified using the second derivative maximum for Cp determination, with the LightCycler 480 software 1.5.0 (Roche).

The isolated RNA was reverse transcribed using the Mir-X™ miRNA First-Strand Synthesis Kit (TaKaRa, Japan) under the following conditions: 37°C for 60 min and 85°C for 5 s. SYBR Green (TaKaRa, Japan) was used as the fluorescent molecule. A U6 (TaKaRa, Japan) endogenous control was used for normalization, and qRT-PCR was performed using the Roche LightCycler 480 system (Roche Applied Science, Germany). All procedures were performed according to the protocols provided by the manufacturer. Amplification curves, melting curve and cycle threshold (Ct) values were analyzed by the LightCycler 480 Software, and only miRNAs with Ct < 35 were included. Data were analyzed using the LightCycler 480 Software 1.5.0 (Roche, Germany). The relative expression of miRNAs was quantified using the 2^−ΔΔCt method.

Total RNAs were extracted from cells at D0, D2, and D7, and also at D14 for ALC cells and from tooth germs at D0 and D9 using respectively RNeasy Mini Kits for the cells and RNeasy Micro Kits (Qiagen) for the molars. Five hundred and fifty nanograms of total RNA were respectively reverse transcribed to first strand cDNA using a Verso cDNA Synthesis Kit (Thermo Fisher Scientific). For quantitative PCR, mouse specific primers for Amelx (F: GATGGCTGCACCACCAAATC, R: CTGAAGGGTGTGACTCGGG), Actin (F: GTGGCATCCATGAAACTACAT, R: GGCATAGAGGTCTTTACGG), GAPDH (F: TGTGTCCGTCGTGGATCTGA, R: TTGCTGTTGAAGTCGCAGGAG) were used. PCR was accomplished in a Lightcycler thermocycler 480R with SYBR® Green Supermix (Bio-Rad) according to the manufacturer's instructions. Values were calculated with the LightCycler® 480 software 1.5.0 (Roche, Applied Science). Results were analyzed by the method of ΔΔCt. All data points were normalized to Actin and/or GAPDH and all samples were run in triplicate. Statistical analyses were conducted with Microsoft Excel 2011 software (Microsoft, Redmond WA, USA). A two-tailed unpaired Student T comparison test was performed (α = 0.05, ^*p < 0.05; ^***p < 10⁻⁴). LRAP(–P) and LRAP(+P) treated samples were compared to the control.

Total RNA was extracted from samples of blood (0.1 ml), foetal br–in, or pups using a NucleoSpin RNA Kit (Macherey-Nagel). RNA concentrations were measured using a NanoDrop spectrophotometer (NanoDrop Technologies) and the samples were kept at −80 °C until use. ZIKV-specific primers were ZIKV-835 5′-TTGGTCATGATACTGCTGATTGC-3′ and ZIKV-911c 5′-CCTTCCACAAAGTCCCTATTGC-3′, as described previously^{4 (link),43 (link)}. Real-time PCR was performed using QuantiTect Reverse Transcription Kit (QIAGEN), SYBR Green I Master Mix, and a LightCycler 480 II instrument (Roche) using the following conditions: initiation at 95 °C for 10 min followed by 50 cycles of 95 °C for 15 s, 60 °C for 30 s, and 72 °C for 30 s. Data were analysed using LightCycler 480 Software 1.5.0 (Roche). Assay sensitivity was determined using samples with known ZIKV concentrations. GraphPad Prism was used as the fitting software.