Total RNA from tissues (50 mg) was isolated by Trizol Reagent (TaKaRa, Tokyo, Japan) and plasma samples (200 μL) were isolated using the Blood Total RNA Rapid Extraction Kit (BioTeke, China). Total RNAs were then reverse transcribed using a PrimeScriptRT Reagent Kit with gDNA Eraser (TaKaRa) following the manufacturer's protocol. HOTAIR expression was measured by real time‐polymerase chain reaction (RT‐PCR) using SYBR Green assays (Takara) in a 7500 Fast Real‐Time PCR System (Applied Biosystems, Foster City, CA, USA). β‐actin was used to normalize the relative levels of lncRNA. Primers were designed with Primer 5, synthesized by Sangon Biotech (Shanghai, China), and sequenced as follows: 5′‐GGTAGAAAAAGCAACCACGAAGC‐3′(forward) and 5′‐GCACGAAGGCTCA TCATTCA‐3′ (reverse) for HOTAIR;5′‐TCCTCTCCCAAGCCACACA‐3′ (forward) and 5′‐GCACGAAGGCTCATCATTCA‐3′ (reverse) for β‐actin. The relative expression was calculated using 2 − ΔΔCt methods.10
Sybr green assay
Manufactured by Takara Bio
Sourced in United States, China, Japan
The SYBR Green assay is a fluorescent-based detection method used in real-time PCR analysis. It functions by binding to double-stranded DNA, emitting a fluorescent signal that can be detected and quantified.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (39 mentions)
Primescript rt reagent kit, by Takara Bio (26 mentions)
Abi 7900 system, by Thermo Fisher Scientific (9 mentions)
Abi 7500 real time pcr system, by Thermo Fisher Scientific (9 mentions)
M mlv reverse transcriptase, by Thermo Fisher Scientific (8 mentions)
Trizol, by Thermo Fisher Scientific (8 mentions)
Lightcycler 480, by Roche (8 mentions)
High capacity cdna reverse transcription kit, by Thermo Fisher Scientific (6 mentions)
Exorneasy midi kit, by Qiagen (5 mentions)
Trizol reagent, by Takara Bio (4 mentions)
Cfx96 instrument, by Bio-Rad (4 mentions)
Abi 7900ht real time pcr system, by Thermo Fisher Scientific (4 mentions)
Primescript rt reagent kit with gdna eraser, by Takara Bio (3 mentions)
Cfx96 system, by Bio-Rad (3 mentions)
Reverse transcriptase kit, by Takara Bio (3 mentions)
Lipofectamine 3000, by Thermo Fisher Scientific (2 mentions)
Mirvana mirna isolation kit, by Thermo Fisher Scientific (2 mentions)
Taqman microrna assay, by Thermo Fisher Scientific (2 mentions)
Rneasy mini kit, by Qiagen (2 mentions)
Abi 7900ht, by Thermo Fisher Scientific (2 mentions)
84 protocols using sybr green assay
1
Quantification of HOTAIR lncRNA Expression
2
Quantifying lncRNA and Coding Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
cDNA was synthesized from total RNA using M-MLV reverse transcriptase (Invitrogen) according to the manufacturer's protocol. qRT-PCR with SYBR Green assays (TaKaRa Biotechnology, Dalian, China) was used to determine expression level of selected lncRNA MDC1-AS and its adjacent coding gene MDC1. A detailed description of qRT-PCR was provided in Supplementary Methods.
3
Gene Expression Analysis of Epithelial Cell Lines
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The normal intestinal epithelial FHC cells was purchased from ATCC and grown in RPMI-1640 (Gibco, United States). The colon cancer cell lines HCT116 and HT29 were obtained from ATCC and grown in McCoy’s 5A (Gibco, United States). All cells culture medium was supplemented with 10% FBS (Gibco) and 1% penicillin and streptomycin (Beyotime, China) and cultured at 37°C in a humidified 5% CO2 atmosphere. Total RNA was extracted from normal and tumor cell lines by Trizol reagent (Invitrogen, Carlsbad, CA, United States). The total RNA was performed to synthesize complementary DNA (cDNA) by using PrimeScript RT reagent Kit (Takara, Japan). The cDNAs were subjected to SYBR Green assays (Takara) based RT-qPCR on a CFX-96 instrument (Bio-Rad Laboratories). The primers used in real-time PCR assays were listed in Supplementary Table S1 . SiRNA was obtained from Genepharma (Shanghai, China) (Supplementary Table S1 ). Oligonucleotide transfection was performed by using Lipofectamine 3000 (Invitrogen, United States), while nonspecific mRNAs were used as negative controls. The Ct values obtained from different samples were compared using the 2−ΔΔCT method. GAPDH served as internal reference genes and all plasmids were constructed by Shanghai Obio Techonology Company, Shanghai, China.
4
Quantitative Analysis of lncRNA Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The total RNA was isolated from tissues and cell lines using TRIzol reagent (Invitrogen, CA, USA), and exosomal RNA was extracted from plasma and culture medium using the exoRNeasy Midi Kit (Qiagen, Valencia, CA, USA) according to the manufacturer’s protocol. The cDNA was synthesized using a high capacity cDNA reverse transcription kit (Thermo Fisher Scientific, Vilnius, Lithuania). Quantitative real-time PCR (qRT-PCR) was conducted with an ABI 7900 system (Applied Biosystems, CA, USA) and SYBR Green assays (TaKaRa Biotechnology, Dalian, China). We chose glyceraldehyde-3-phosphate dehydrogenase (GAPDH) to normalize lncRNA expression levels. The fold change in the expression of lncRNA was calculated with the formula 2-ΔCT. The primer sequences are shown in Additional file 1 : Table S1.
5
Quantification of lncRNA Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The total RNA was isolated from tissues and cell lines using TRIzol reagent (Invitrogen, CA, USA), and exosomal RNA was extracted from plasma and culture medium using the exoRNeasy Midi Kit (QIAGEN, Valencia, CA, USA), according to the manufacturer’s protocol.
The cDNA was synthesized using a high-capacity cDNA reverse transcription kit (Thermo Fisher Scientific, Vilnius, Lithuania). Real-time qPCR was conducted with an ABI 7900 system (Applied Biosystems, CA, USA) and SYBR Green assays (TaKaRa Biotechnology, Dalian, China). We chose glyceraldehyde-3-phosphate dehydrogenase (GAPDH) to normalize lncRNA expression levels. The fold change in the expression of lncRNA was calculated with the formula 2 − ΔCT. The sequences of the primers were as follows: SPRY4-IT1 forward, 5′-AGCCACATAAATTCAGCAGA-3′, reverse, 5′-CGATGTAGTAGGATTCCTTTCA-3′; and GAPDH forward, 5′-GACTCATGACCACAGTCCATGC-3′, reverse, 5′-AGAGGCAGGGATGATGTTCTG-3′. An ABI 7500 was used to carry out the qPCR and data collections.
The cDNA was synthesized using a high-capacity cDNA reverse transcription kit (Thermo Fisher Scientific, Vilnius, Lithuania). Real-time qPCR was conducted with an ABI 7900 system (Applied Biosystems, CA, USA) and SYBR Green assays (TaKaRa Biotechnology, Dalian, China). We chose glyceraldehyde-3-phosphate dehydrogenase (GAPDH) to normalize lncRNA expression levels. The fold change in the expression of lncRNA was calculated with the formula 2 − ΔCT. The sequences of the primers were as follows: SPRY4-IT1 forward, 5′-AGCCACATAAATTCAGCAGA-3′, reverse, 5′-CGATGTAGTAGGATTCCTTTCA-3′; and GAPDH forward, 5′-GACTCATGACCACAGTCCATGC-3′, reverse, 5′-AGAGGCAGGGATGATGTTCTG-3′. An ABI 7500 was used to carry out the qPCR and data collections.
6
Exosomal RNA Extraction and lncRNA Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The separation of total RNAs from tissues and cell lines was achieved by using TRIzol reagent (Invitrogen, CA, USA). ExoRNeasy Midi Kit (Qiagen, Valencia, CA, USA) was utilized for exosomal RNA extraction from plasma and culture medium according to the manufacturer’s instructions. cDNA synthesis was performed using a high-capacity cDNA reverse transcription kit (Thermo Fisher Scientific, Vilnius, Lithuania). Subsequently, an ABI 7900 system (Applied Biosystems, CA, USA) and SYBR Green assays (TaKaRa Biotechnology, Dalian, China) were adopted for qRT-PCR. LncRNA expression level was normalized with GAPDH as internal control, and 2−ΔCt method was adopted to assess the fold change in lncRNA expression. The primer sequences used were as follows: SENP3-EIF4A1: F 5′ CCGCCAGTTCTACATCAACG 3′, R 5′ TTCCTCCGGGTGTTGATGAA 3′, GAPDH: F 5′ CCGGGAAACTGTGGCGTGATGG 3′, R 5′ AGG TGGAGGAGTGGGTGTCGCTGTT 3′, ZFP36: F 5′ GACTGAGCTATGTCGGACCTT 3′, R 5′ GAGT TCCGTCTTGTATTTGGGG 3′.
7
Extraction and Expression Analysis of lncRNA MT1JP
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The total RNA from GC tissue or cell lines were extracted using Trizol Reagent (Invitrogen, CA, USA) and mirVana miRNA Isolation Kit (Applied Biosystems) according to the manufacturer’s instructions. M-MLV reverse transcriptase (Invitrogen) was used for lncRNA MT1JP reverse transcription. The expression of lncRNA MT1JP and FBXW7 was detected by ABI 7900HT Real-Time PCR System (Applied Biosystem, Foster City, CA, USA), using SYBR Green assays (TaKaRa Biotechnology, Dalian, China) and GAPDH was used as the internal control. The expression of miR-92a-3p was measured using TaqMan MicroRNA Assays (Applied Biosystems) and U6 was treated as an internal control. All the primer sequences were available in Additional file 1 : Table S2.
8
Quantitative RNA Expression Analysis in CRC
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from CRC patient tissues using TRIzol reagent (Invitrogen, Carlsbad, CA, USA). Complementary DNA (cDNA) was synthesized using the total RNA and a PrimeScript RT reagent kit (Takara). SYBR-Green assays (Takara) were used to perform the RT-qPCR on a CFX-96 instrument (Bio-Rad Laboratories, Inc., USA). The data were compulated through the 2-ΔΔC t strategy, normalizing with GAPDH. The primer sequences used for qRT-PCR in this study are listed in Table S3.
9
Quantification of lncRNA, mRNA, and miRNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA in cells was separated through TRlzol reagent (Invitrogen, USA), and reverse transcribed by PrimeScript RT reagent Kit (TaKaRa, Japan). Expressions of lncRNA and mRNA were measured by ABI 7900HT RealTime PCR System (Applied Biosystem, USA) using SYBR Green assays (TaKaRa, Japan), GAPDH was regarded as control. MiRNA level was analyzed by TaqMan MicroRNA Assays (Applied Biosystems, USA), and U6 was regarded as control. Primer sequences used:
| LncRNA AL139002.1 | Forward, 5′-TTCTCTGTGTCAGGCCTTTGA-3′ |
| LncRNA AL139002.1 | Reverse, 5′-GCAGGAACAGGCCATTTTCA-3′ |
| miR-490-3p | Forward, 5′-CGCAACCTGGAGGACTCC-3′ |
| miR-490-3p | Reverse, 5′-AGTGCAGGGTCCGAGGTATT-3′ |
| HAVCR1 | Forward, 5′-TGGTGGGAGATAGAGGAAGCAT-3′ |
| HAVCR1 | Reverse, 5′-GATCAGCGTTCAGATCCAGG-3′ |
| GAPDH | Forward, 5′-CTCAGACACCATGGGGAAGGTGA-3′ |
| GAPDH | Reverse, 5′- ATGATCTTGAGGCTGTTGTCATA-3′ |
| U6 | Forward, 5′-CTCGCTTCGGCAGCACA-3′ |
| U6 | Reverse, 5′-AACGCTTCACGAATTTGCGT-3′ |
10
RNA Extraction and RT-qPCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The extraction of total RNA from the tissues was conducted using TRIzol reagent (Invitrogen, Carlsbad, CA, USA). The extracted RNA was reverse transcribed into cDNA using the PrimeScript RT Reagent Kit (RR047A, Takara, Japan). The mRNA expression levels of our signature genes in the two groups were analyzed with SYBR-Green assays (Takara) using the CFX-96 instrument (Bio-Rad Laboratories, Inc., Hercules, CA, USA). The relative mRNA expression levels of the genes were calculated using the 2−∆∆Ct method, and the GAPDH gene was selected as the internal control. Our primer sequences are listed in Supplementary Table S3 .
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!