Turbofect transfection

LncRNA‐HIT cDNA was cloned into the pLVX lentiviral vector (Addgene, Cambridge, MA). Virus was made using Turbofect transfection (Thermo, Boston, MA) into 293T cells. Virus was filtered and then infected into cells with polybrene for 24 h. Cells were selected with 3 μg/mL puromycin (Invitrogen, Carlsbad, CA). The pLKO.1 shRNA lentiviral system was used to knockdown genes of interest. pLKO.1, pLKO.1‐shHIT‐1, and pLKO.1‐shHIT‐2 were purchased from Genechem Company, Shanghai, China. Target sequences for shRNAs are as follows: shHIT‐1: GTCTCACATACCTTCCTAACTCTAG, shHIT‐2: CCTCCAAGGTGGTCTGTGACCTTAA. puromycin at 3 μg/mLwas used to select stable cells.

Chinese hamster ovary (CHO-K1) cells and African green monkey kidney epithelial cells (Vero E6 cells) were maintained in Dulbecco’s modified Eagle’s medium (DMEM, PAA Laboratories GmbH, Austria) supplemented with 10% fetal bovine serum, 2 mM L-glutamine, 100 U/mL penicillin, and 100 μg/mL streptomycin (all PAA Laboratories GmbH, Pasching, Austria). Then, 24–48 h prior to imaging experiments, expression plasmids were introduced into pre-plated cells in 35-mm glass-bottom Microwell Dishes (MatTek Corporation, Ashlands, MA, USA) by Turbofect transfection (Thermo Scientific, Waltham, MA, USA) according to the manufacturer’s instructions. All cell lines other than CHO-K1 (Figure S2: A549, HEK293T, MGLU-2-R [17 (link)], and MGN-2-R [17 (link)]) were seeded in a standard 12-well tissue culture plate (Greiner, Kremsmünster, Austria) on 18-mm glass cover slips (#1.5, Menzel, Thermo Scientific, Waltham, MA, USA). The cells were seeded at a density of 150.000 cells per well and cultivated in DMEM with 10% fetal calf serum (Sigma-Aldrich, Gillingham, UK). After 24 h, the cells were transfected with 1 µg plasmid DNA per well using jetOptimus (Polyplus, Illkirch, France) transfection reagent. The medium was changed after 6 h, and the cells were further incubated for 12–16 h, then fixed, stained, and mounted on microcopy glass slides (ProLong Gold, ThermoFisher, Waltham, MA, USA).

HEK293T cells were cotransfected with pLVX-AcGFP-N1 constructs and the packaging plasmids pMD.G and pCMVR8.91 using Turbofect transfection (#MBIR0531; Thermo Fisher Scientific) according to the manufacturer’s recommendations. The supernatants containing the lentivirus were harvested 48 and 72 h after transfection. Immortalized macrophage progenitors, HEK293T, or MEFs were transduced with lentiviruses in the presence of 8 μg/ml polybrene by spin inoculation at 1,500 g for 60 min and cultured in fresh medium for another 24 h. The infected cells were then selected in 2.5–5 μg/ml puromycin (#P600-100; Gold Biotechnology) containing medium until the uninfected cells were completely eliminated. The stable colonies were pooled for further experiments.