Log In Sign up
The largest database of trusted experimental protocols

Human β actin

Manufactured by Eurofins
Visit Supplier

Human β-actin is a structural protein that is part of the cytoskeleton within eukaryotic cells. It plays a fundamental role in cell motility, structure, and integrity.

Automatically generated - may contain errors

Lab products found in correlation

Superscript 3 reverse transcriptase, by Thermo Fisher Scientific (2 mentions) Powerup sybr green master mix, by Thermo Fisher Scientific (2 mentions) Rneasy kit, by Qiagen (2 mentions)

Spelling variants of this product

β-actin (16 citations)

2 protocols using human β actin

1

Quantification of β-actin and NR4A1 mRNA Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was extracted from cells using RNeasy Kits (74004; QIAGEN) following the manufacturer’s instructions. cDNA synthesis was performed using SuperScript III Reverse Transcriptase (18080044; Thermo Fisher Scientific) with 100 ng RNA as the template. Amplification of cDNA was carried out using 2× PowerUP SYBR Green Master Mix (A25778; Thermo Fisher Scientific). Each reaction was conducted in triplicates and results were normalized to the expression of a housekeeping gene. Primer (Eurofins): human β-actin (forward sequence: 5′-CAC​CAT​TGG​CAA​TGA​GCG​GTT​C-3′; reverse sequence: 5′-AGG​TCT​TTG​CGG​ATG​TCC​ACG​T-3′) and human NR4A1 (forward sequence: 5′-GGA​CAA​CGC​TTC​ATG​CCA​GCA​T-3′; reverse sequence: 5′-CCT​TGT​TAG​CCA​GGC​AGA​TGT​AC-3′).
Wang L., Xiao Y., Luo Y., Master R.P., Mo J., Kim M.C., Liu Y., Maharjan C.K., Patel U.M., De U., Carelock M.E., Tithi T.I., Li X., Shaffer D.R., Guertin K.R., Zhuang H., Moser E., Smalley K.S., Lv D., Zhou D., Zheng G, & Zhang W. (2024). PROTAC-mediated NR4A1 degradation as a novel strategy for cancer immunotherapy. The Journal of Experimental Medicine, 221(3), e20231519.
+ Open protocol
+ Expand
2

Quantitative Analysis of NR4A1 Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was extracted from cells using RNeasy Kits (74004, QIAGEN) following the manufacturer’s instructions. cDNA synthesis was performed using SuperScript™ III Reverse Transcriptase (18080044, Thermo Fisher) with 100 ng/μL RNA as the template. Amplification of cDNA was carried out using 2X PowerUP SYBR Green Master Mix (Thermo Fisher, A25778). Each reaction was conducted in triplicates, and results were normalized to the expression of a housekeeping gene. Primer (Eurofins) : human β-actin (Forward Sequence: CACCATTGGCAATGAGCGGTTC; Reverse Sequence: AGGTCTTTGCGGATGTCCACGT), human NR4A1 (Forward Sequence: GGACAACGCTTCATGCCAGCAT; Reverse Sequence: CCTTGTTAGCCAGGCAGATGTAC).
Wang L., Xiao Y., Luo Y., Master R.P., Mo J., Kim M.C., Liu Y., Patel U.M., Li X., Shaffer D., Guertin K.R., Moser E., Smalley K.S., Zhou D., Zheng G, & Zhang W. (2023). Unleashing the Power of NR4A1 Degradation as a Novel Strategy for Cancer Immunotherapy. bioRxiv.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!