Total RNA was isolated from homogenized liver tissues using a TRIzol™ isolation kit (Takara Bio, Dalian, China) following the manufacturer's protocol. The cDNA was synthesized by using Primer Script RT kit (Takara Bio, Dalian, China). Prime Script™ RT reagent kits, along with SYBR Green Realtime PCR Master Mix and Permix Ex Taq (Takara Bio), according to the manufacturer's instructions. The primers for GAPDH, TNF-α, IL-10, TGF-β1, α-SMA, and Desmin were synthesized by Sangon Biotech (Shanghai, China). Real-Time PCR was operated on ABI Prism 7500 Sequence Detection System (BioRad, Life Science Research, Hercules, CA, USA). PCR conditions were as follows: one cycle at 95°C for 30 s, 40 cycles at 95°C for 5 s, at 64°C for 30 min. All reactions were performed in triplicate for each sample. The 2−ΔΔCT method was used to calculate relative concentration of each target by standardizing to internal GAPDH level.
Abi prism 7500 sequence detection system
Manufactured by Bio-Rad
Sourced in United States
The ABI Prism 7500 Sequence Detection System is a real-time PCR (polymerase chain reaction) instrument used for gene expression analysis, genotyping, and other nucleic acid quantification applications. It provides accurate and reliable data through its advanced optics and thermal cycling capabilities. The system utilizes fluorescence detection to monitor the amplification of DNA or RNA targets in real-time.
Automatically generated - may contain errors
Lab products found in correlation
Primescript rt reagent kit, by Takara Bio (3 mentions)
Trizol reagent, by Thermo Fisher Scientific (2 mentions)
Ssofast evagreen supermix, by Bio-Rad (2 mentions)
Sybr green real time pcr master mix, by Takara Bio (1 mentions)
Primerscript rt kit, by Takara Bio (1 mentions)
Permix ex taq, by Takara Bio (1 mentions)
Mir x mirna first strand synthesis kit, by Takara Bio (1 mentions)
Trizol, by Thermo Fisher Scientific (1 mentions)
Primescript rt master mix kit, by Takara Bio (1 mentions)
Sybr green pcr master mix, by Bio-Rad (1 mentions)
Ab133327, by Abcam (1 mentions)
Ecl reagent, by Thermo Fisher Scientific (1 mentions)
Bca assay kit, by Sangon (1 mentions)
Pvdf membrane, by Merck Group (1 mentions)
Ripa buffer, by Beyotime (1 mentions)
4 protocols using abi prism 7500 sequence detection system
1
Liver Tissue RNA Extraction and Gene Expression Analysis
2
Quantitative analysis of SNHG17 and miR-338-3p in ESCC
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from ESCC tissues and cells utilizing TRIzol reagent (Invitrogen). cDNA synthesis was with a PrimeScript RT reagent Kit (Takara, Japan). RT-qPCR was performed with SsoFast EvaGreen Supermix (Bio-Rad, USA) and an ABI Prism 7500 Sequence Detection System according to the manufacturer’s instructions. miR-338-3p was detected with a Mir-X miRNA First-Strand Synthesis Kit (Clontech, USA) according to the manufacturer’s instructions. Primer sequences were as follows: SNHG17 F:GTTCCTGGGGCTTGGATGAT, SNHG17 R: GATCTAAGGCTGAGACCCACG; β-actin F:TGGCACCCAGCACAATGAA, β-actin R: CTAAGTCATAGTCCGCCTAGAAGCA; and miR-338-3p F:TCCAGCATCAGTGATTTTGTTG. Relative gene expression was normalized to β-actin or U6 based on the 2−ΔΔCtmethod.
3
Quantifying Liver Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was purified from liver tissue samples using Trizol (Invitrogen) according to manufacturer's protocol. Reverse transcript was performed using PrimeScript RT Master Mix kit (Takara). Real time PCR was carried out in SYBR Green PCR Master Mix (Bio-Rad) with ABI PRISM 7500 Sequence Detection System. Primer sequences are listed in Supplementary Table S1 . Each measurement was performed in triplicate and results were normalized to the expression of gapdh reference gene.
4
Western Blot and RT-qPCR Analysis of CKAP2L, CDK1, and Cyclin B1
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total protein was isolated by lysing cells with RIPA buffer (Beyotime, China) and was quantified with a BCA assay kit (Sangon, China). Total protein (50 μg) was separated by electrophoresis (10% SDS-PAGE) and transferred to a PVDF membrane (Millipore, USA). After treatment with a skim milk powder for 2 h at room temperature, the membrane was incubated overnight with a primary antibody reactive with either; CKAP2L (ab221897, Abcam), CDK1 (ab133327, Abcam), Cyclin B1 (4138, CST), or GAPDH (5174, CST) at 4°C. The next day, secondary antibodies conjugated with horseradish peroxidase (HRP) were incubated with the membranes for 2 h. Protein signals were detected with ECL reagents (Invitrogen) [34 (link)].
Total RNA was isolated from ESCC tissues and cells using TRIzol reagent (Invitrogen). cDNA synthesis was done with a PrimeScript RT reagent Kit (Takara, Japan). RT-qPCR was performed with SsoFast EvaGreen Supermix (Bio-Rad, USA) and an ABI Prism 7500 Sequence Detection System according to the manufacturer's instructions. The primers used were as follows: CKAP2LF: GGGAAAACTGAAGAGCCAAAACA; CKAP2LR: AGGTTTGACAGGCAAAACAACA;β-actin F: TGGCACCCAGCACAATGAA,β-actin R: CTAAGTCATAGTCCGCCTAG AAGCA. Relative gene expression was normalized to β-actin based on the 2−ΔΔCt method [35 (link)].
Total RNA was isolated from ESCC tissues and cells using TRIzol reagent (Invitrogen). cDNA synthesis was done with a PrimeScript RT reagent Kit (Takara, Japan). RT-qPCR was performed with SsoFast EvaGreen Supermix (Bio-Rad, USA) and an ABI Prism 7500 Sequence Detection System according to the manufacturer's instructions. The primers used were as follows: CKAP2LF: GGGAAAACTGAAGAGCCAAAACA; CKAP2LR: AGGTTTGACAGGCAAAACAACA;β-actin F: TGGCACCCAGCACAATGAA,β-actin R: CTAAGTCATAGTCCGCCTAG AAGCA. Relative gene expression was normalized to β-actin based on the 2−ΔΔCt method [35 (link)].
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!