Inverted confocal microscope

In order to evaluate the level of autophagy, 5×10⁴ OVCAR-3 or A2780 cells were seeded in glass bottom cell culture dishes (code 801002, NEST, Wuxi, China). After 24 h, these cells were transfected with the plasmid of GFP-tagged LC3 plasmid (Addgene, #11546) or RFP-GFP-targeted LC3 (provided by Yoshimori) using Lipofectamine 3000 (Invitrogen, Thermo Fisher Scientific, USA) for 24 h. Subsequently, these cells were treated by vehicle or 1 μM SRT2183 for 24 h. Fluorescence images of live cells were directly taken using an inverted confocal microscope (Zeiss, Oberkochen, Germany) and 60× oil objective [35 (link)].

After decapitation, the cortex from WT mice was dissected, snap-frozen in isopentane and then stored at −70 °C until being sectioned on a cryostat. Twenty micrometer-thick transversal or coronal sections were mounted on slides. Slices were treated with 4% Parafomaldeyde for 30’ and washed with saline-sodium citrate (SSC) buffer 0,5X twice for 10 min. The slices were then treated with Proteinase K solution (7 μg/μL Proteinase K, 0,5 M NaCl, 10 M Tris-HCl, pH 8.0) for 30 min and then treated with pre-Hybridization solution (50% formammide, 4X SSC, 1X Denhardt’s Solution, 2 mM EDTA, 500 μg/ml ssDNA) for 2 h at 42 °C. Digoxigenin-labeled BC1 RNA antisense was hybridized on tissue sections overnight at 53 °C and detected with the use of anti-digoxigenin–HRP conjugate (Roche) and a commercial cyanine-5 tyramide signal amplification kit (TSA-CY3; PerkinElmer). Sections were counterstained for nuclei with Hoechst (Hoechst; Life technologies). The specificity of the labeling was monitored by omitting the riboprobe or using BC1 sense RNA probe. Images were acquired using an inverted confocal microscope (Zeiss).
BC1 RNA sense and antisense digoxigenin-labeled riboprobes sequences are:
AS Probe Exiqon: Probe: /5DigN/AAAGGTTGTGTGTGCCAGTTA/3DigN/
Position in target (BC1 sense): 134–154
Sense Probe Exiqon: Probe: /5DigN/AAACAAGGTAACTGGCACACA/3DigN/
Position in target (BC1 sense): 126- 146

For in vivo imaging, laser-mediated axotomy, and some Emx2 immunostaining, we used a custom-built inverted spinning disc microscope (Zeiss Axioscope). Emx2 immunostainings in wild type with single neurons labeled were imaged using a Zeiss inverted confocal microscope with a 40× water immersion objective. Embryos and larvae used for in vivo imaging were anesthetized in MS-222 (tricaine) 0.16 g/L and mounted in 1% low–melting-point agarose on the cover slip of a glass-bottom dish (MatTek, Ashland, MA). Imaging dishes were bathed in Danieau’s with MS-222 0.16 g/L, except for time-lapse imaging where concentration was reduced to 0.08 g/L. Acquisition was performed at 28.5 °C using a 63× water immersion objective.

Cells were stably transfected with pRFP-H2B and cultured in a live-cell instrument (LCI, Gyeonggi-do, Republic of Korea). Fluorescent images were recorded using an inverted confocal microscope (ZEISS, Oberkochen, Germany), and transmitted light images were recorded using DIC optics.