Absolute sybr green rox mix

The expression levels of selected transcripts were confirmed by real-time polymerase chain reaction (RT-PCR) using absolute SYBR green ROX Mix (ThermoFisher Scientific, Rochester, NY, USA) as previously described [52 (link)]. OVCAR-8 and NCI/ADR-RES cells were treated with NCX4040 (5 µM) for 4, 24, 48 h in the complete media. Following treatment, cells were washed once with PBS (pH 7.4) and RNA was extracted with TRIzol (Ambion Life Technology, Grand Island, NY, USA). RNA was isolated and purified with RNA easy mini kit columns (Qiagen, Valencia, CA, USA). Data were analyzed using ΔΔCt method of relative quantification in which cycle times were normalized to β-actin (or GADPH) from the same sample. Primers for the selected genes were designed using Primer Express 1.0 software and synthesized by Integrated DNA Technologies, San Diego, CA, USA) and in some cases were purchased from Origene Technologies (Gaithersburg, MD, USA). All real-time fluorescence detection was carried out on an iCycler (Bio-Rad, Hercules, CA, USA).

Samples of 1 μg total RNA treated with TURBO DNase I (Ambion) was used as a template for first-strand cDNA synthesis in a volume of 20 μl with 1 μl of Superscript III reverse transcriptase (Invitrogen). cDNAs were used as templates for quantitative real-time PCR (qRT-PCR). Amplification reactions were carried out with the StepOnePlus real-time PCR system (Applied Biosystems) using Absolute SYBR Green ROX mix (Thermo Scientific) for quantitation. Three biological replicates were analyzed. The 2^-ΔΔCT method was applied to determine relative transcript levels [32 (link)]. Reactions for each tested gene in each cDNA sample were independently repeated at least three times. EF1alpha (At5g60390) was used as a reference (for primer sequences, see [33 (link)]). Specific primers for amplification of PRORP1 (At2g32230) were Pprorp1_5’ (5'-GTTTGATGCAGTCATTGATGGAGC-3') and Pprorp1_3’ (5'-TACACGACTCTTGTGCAGGATCAC-3').

Total mRNA were extracted using TRIzol reagent (Thermofisher), isolated from other cellular materials by chloroform/isoamyl alcohol (24:1) precipitation before centrifugation (12,000 × g, 4°C, 15 min), as described elsewhere [34 (link)]. 250 ng total mRNA were reverse-transcribed using VERSO cDNA kit (Thermofisher) according to the manufacturer instructions. Real-time PCR was then performed using an Absolute SYBR Green Rox mix (Thermofisher) and a CFX 96 real time PCR detection system (Bio-Rad, Hercules, CA, USA). The cycle threshold (Ct) values were recorded using Bio-Rad CFX Manager 3.0 software (Bio-Rad) [34 (link)]. PCR primers were synthesized by Eurogentec (Liege, Belgium) as follow (5’-3’): for LRP1: GCTATCGACGCCCCTAAGAC and CGCCAGCCCTTTGAGATACA; for ITGB1: CATCTGCGAGTGTGGTGTCT and GGGGTAATTTGTCCCGACTT; for RS18: GCAGAATCCACGCCAGTACAA and GCCAGTGGTCTTGGTGTGCT; for RPL32: CATTGGTTATGGAAGCAACAAA and TTCTTGGAGGAAACATTGTGAG.

Total RNA was isolated from tissue homogenates using the RNeasy Mini kit (Qiagen). Reverse transcription of 0.5 µg total RNA was performed in the presence of oligo(dT)12–18 and dNTPs (Invitrogen) with SuperScript_II reverse transcriptase (Invitrogen) according to the manufacturer's instructions. Real‐time qPCR was performed using the Applied Biosystems 7900HT Real‐Time PCR System. Each reaction contained 5 ng cDNA, 10 pM primers (listed in Table 1) and ABsolute SYBR Green Rox mix (Thermo Scientific, Landsmeer, NL). No‐template controls were performed to ensure that amplification was not a result of contamination with genomic DNA. Gene expression levels were analyzed using the 2^−ΔΔct method (Livak, 2001), and relative expression to HPRT1 or GAPDH. Similar results were obtained for both housekeeping genes.

Overnight-grown EPEC organisms were subcultured in high-glucose DMEM. Following centrifugation, cell pellets were reconstituted in Tris-acetate-EDTA (TAE) buffer and three freeze-thaw cycles were performed. Total RNA was extracted (Direct-zol RNA miniprep kit; Zymo), and 1.5 μg was treated with RQ1 DNase I (Promega; 1 U/μg of RNA). cDNA was synthesized with a qPCRBIO high-quality cDNA synthesis kit and quantified by real-time PCR using a SYBR green mix (Absolute SYBR green ROX mix; Thermo). 16S rRNA (rrsB) was used as a housekeeping gene. Primers for qRT-PCR are shown in Table S3.

All qRT-PCR experiments were analyzed in accordance with the MIQE guidelines (Bustin et al. 2009 (link)). For each sample, 2.2 × 10⁶ of each cell line was plated into 10 cm plates in RPMI-1640 plus 10 % FCS and penicillin/streptomycin and grown for 1, 3 or 5 days. The cells were then harvested for total RNA preparation using the RNEasy kit (Qiagen, Hilden, Germany). Genomic DNA removal and first-strand synthesis (1 µg total RNA) were performed using the Quantitect Reverse Transcription Kit (Qiagen, Hilden, Germany) according to the manufacturer’s instructions. The 20 µl first-strand syntheses were diluted 1/3 in water and 2 µl was used for quantitative real-time PCR together with 10 pmol of the appropriate primer pairs (see Supplementary Table 1) and 6 µl Absolute SYBR Green Rox Mix (Thermo Scientific, Schwerte, Germany). The reaction mixtures were amplified/quantified using the 7900HT Real-Time PCR System thermocycler (Life Technologies, Darmstadt, Germany) using the following cycling conditions 50 °C—2 min, 95 °C—15 min, 40 cycles of 95 °C—15 s, 60 °C—1 min for amplification followed by 95 °C—15 s, 60 °C—15 s for annealing curve determination. Standard curves were performed for each of the amplifications. The genes of interest were normalized against the housekeeping genes DCTN2 and PGK1.