Purelink genomic dna isolation kit

Manufactured by Thermo Fisher Scientific

Sourced in United States

The PureLink® Genomic DNA Isolation Kit is a tool designed for the rapid isolation of high-quality genomic DNA from a variety of sample types, including animal tissues, cells, blood, and bacteria. The kit utilizes a silica-based membrane technology to efficiently capture and purify DNA, while removing contaminants and inhibitors.

Automatically generated - may contain errors

Lab products found in correlation

Close spelling variants of this product

Genomic DNA kit DNA isolation kit PureLink kit

19 protocols using purelink genomic dna isolation kit

Quantitative PCR Analysis of EPCs

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

For these experiments, we used Real 7900 HT PCR (as above), TaqMan Universal PCR Master Mix-4304437, Human GAPDH-Hs03929097_g1, and a 384-well PCR plate (Thermo Fisher Scientific, Waltham, MA, USA). Human EPCs (4 × 10⁴), untreated or DHT-treated (30 nM), were incubated as described for immunocytochemistry experiments. After 48 h, DNA was isolated using the PureLink Genomic DNA Isolation Kit (Life Technologies, Waltham, MA, USA) and quantified by the NanoDrop ND-1000 UV-VIS spectrophotometer. To accurately determine the relative cellularity, a calibration curve was established by serially diluting standardized DNA extracted from a reference sample of 4 × 10⁴ EPCs to a final dilution of 2500 equivalent cells [56 (link)]. In addition, for the design of oligonucleotide sequences, we compared the human genome to the mouse genome using the Genome ARTIST V1 software [57 (link)]. Experimental conditions for PCR were chosen according to the manufacturer’s specifications, and all experiments were performed in triplicate.

Popa M.A., Mihai C.M., Șuică V.I., Antohe F., Dubey R.K., Leeners B, & Simionescu M. (2024). Dihydrotestosterone Augments the Angiogenic and Migratory Potential of Human Endothelial Progenitor Cells by an Androgen Receptor-Dependent Mechanism. International Journal of Molecular Sciences, 25(9), 4862.

+ Open protocol

+ Expand

Sanger Sequencing of CTCF Exons

Check if the same lab product or an alternative is used in the 5 most similar protocols

Genomic DNA was extracted from Ishikawa, HEC1A, HEC1B, RL95-2 and KLE endometrial cancer cell lines using the Purelink genomic DNA isolation kit (Life Technologies). PCR amplicons spanning CTCF exons 3-11 including splice sites were amplified with established primers^{17 (link)} using Phusion DNA Polymerase (NEB, Ipswich, MA, USA). Each PCR product was Sanger sequenced in forward and reverse directions. All mutations were confirmed by cloning each PCR amplicon into pCR-Blunt-TOPO (Life Technologies) and re-sequencing.

Marshall A.D., Bailey C.G., Champ K., Vellozzi M., O'Young P., Metierre C., Feng Y., Thoeng A., Richards A.M., Schmitz U., Biro M., Jayasinghe R., Ding L., Anderson L., Mardis E.R, & Rasko J.E. (2017). CTCF genetic alterations in endometrial carcinoma are pro-tumorigenic. Oncogene, 36(29), 4100-4110.

+ Open protocol

+ Expand

Quantifying SOX10 Promoter Methylation

Check if the same lab product or an alternative is used in the 5 most similar protocols

SOX10 CpG Island (Chr22: 38379093-38379964 (hg19), containing 82 CpG) whose methylation status inversely correlates with SOX10 transcription [17 (link)] was examined by MethylScreen technology[18 (link)], using the Epitect methyl II PCR assay (catalog# EPHS109833-1A, Qiagen) as per manufacturer's instructions (Epitect methyl II PCR assay Handbook – Qiagen). Genomic DNA was isolated from KC and the corresponding KC-NC (n=5 donors) using PureLink genomic DNA isolation kit (Life Technologies). One µg of genomic DNA from both KC and the respective KC-NC was mock-digested (no enzyme) or digested with methylation-dependent (digests methylated DNA) and methylation-sensitive (digests unmethylated and partially methylated DNA) restriction enzymes (provided with EpiTect Methyl II DNA Restriction Kit (Qiagen)) individually or together. Methylation status of the target sequence was measured using quantitative real time PCR with target sequence specific probes. The raw ∆CT values from all 4 restriction digestion groups were plugged in the data analysis spreadsheet (http://www.sabiosciences.com/dna_methylation_data_analysis.php), which automatically calculates the relative amount of methylated and unmethylated DNA fractions.

Bajpai V.K., Kerosuo L., Tseropoulos G., Cummings K.A., Wang X., Lei P., Liu B., Liu S., Popescu G., Bronner M.E, & Andreadis S.T. (2017). Reprogramming postnatal human epidermal keratinocytes toward functional neural crest fates. Stem cells (Dayton, Ohio), 35(5), 1402-1415.

+ Open protocol

+ Expand

Screening for CTCF Mutations in Endometrial Cancer

Check if the same lab product or an alternative is used in the 5 most similar protocols

Genomic DNA was extracted from Ishikawa, HEC1A, HEC1B, RL95-2 and KLE endometrial cancer cell lines using the Purelink genomic DNA isolation kit (Life Technologies). PCR amplicons spanning CTCF exons 3–11 including splice sites were amplified with established primers^{47 (link)} using Phusion DNA Polymerase (NEB). Each PCR product was Sanger sequenced in forward and reverse directions. All mutations were confirmed by cloning each PCR amplicon into pCR-Blunt-TOPO (Life Technologies) and re-sequencing.

+ Open protocol

+ Expand

DNA Isolation and Quantification Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols

Genomic DNA was isolated using the PureLink Genomic DNA isolation kit (Thermo Fisher) and quantified using the Epoch Microplate Spectrophotometer (BioTek).

Findlay S.D., Vincent K.M., Berman J.R, & Postovit L.M. (2016). A Digital PCR-Based Method for Efficient and Highly Specific Screening of Genome Edited Cells. PLoS ONE, 11(4), e0153901.

+ Open protocol

+ Expand

CRISPR/Cas9-mediated Biallelic SLC30A10 Mutation

Check if the same lab product or an alternative is used in the 5 most similar protocols

CRISPR/Cas9-mediated biallelic SLC30A10 mutation was performed by GenScript (Piscataway, NJ). Briefly, the guide RNA (gRNA) targeting SLC30A10 exon 1 (forward TGGCGAGATGGGCCGCTACT; reverse CGGCGCAGTCCTGGAAGATGA) was designed and evaluated for on-target cleavage efficiency, then cloned into pGS-gRNA-CMV-SpCas9-puro2 vector. Hep3B cells were transfected with the gRNA-Cas9 construct using Lipofectamine 3000 (ThermoFisher, L3000-015). Transfected cells were enriched by puromycin selection. Isogenic clones were generated and confirmed to carry biallelic mutations at the targeted site by sequencing. To confirm SLC30A10 mutations, genomic DNA was extracted from cells using PureLink genomic DNA isolation kit (ThermoFisher, K1820-01), followed by PCR amplification of exon 1 (SLC30A10). The amplified DNA was then cloned and transformed into competent cells using TOPO^® TA Cloning^® kit (ThermoFisher, K4530-20). Cultures of transformants were used to isolate plasmid DNA followed by Sanger sequencing (Genewiz, MA). DNA sequence files were analyzed using Geneious (V10.2) software.

Prajapati M., Pettiglio M.A., Conboy H.L., Mercadante C.J., Hojyo S., Fukada T, & Bartnikas T.B. (2021). Characterization of in vitro models of SLC30A10 deficiency. Biometals : an international journal on the role of metal ions in biology, biochemistry, and medicine, 34(3), 573-588.

+ Open protocol

+ Expand

Bisulfite Modification of Genomic DNA

Check if the same lab product or an alternative is used in the 5 most similar protocols

Genomic DNA was isolated from MSCs using PureLink^® Genomic DNA isolation kit following the manufacturer’s instructions (Invitrogen). Bisulfite modification was done as described previously51 (link). Briefly, about 2 μg of genomic DNA was denatured by NaOH (final concentration, 0.2 mol/L) for 10 min at 37 °C. Hydroquinone and sodium hydroxide were added, and samples were incubated at 50 °C for 16 h. Modified DNA was purified using Wizard DNA Clean-Up System following the manufacturer’s instructions (Promega) and eluted into 50 μL water. DNA was treated with NaOH (final concentration, 0.3 mol/L) for 5 min at room temperature, ethanol precipitated, and resuspended in 20 μL water. Modified DNA was used immediately or stored at −20 °C.

Rui Y., Xu L., Chen R., Zhang T., Lin S., Hou Y., Liu Y., Meng F., Liu Z., Ni M., Sze Tsang K., Yang F., Wang C., Chang Chan H., Jiang X, & Li G. (2015). Epigenetic memory gained by priming with osteogenic induction medium improves osteogenesis and other properties of mesenchymal stem cells. Scientific Reports, 5, 11056.

+ Open protocol

+ Expand

Genotyping of p73 Polymorphism

Check if the same lab product or an alternative is used in the 5 most similar protocols

Genomic DNA was prepared from either blood/buccal samples (control) or formalin-fixed paraffin embedded normal prostate tissue blocks (cases) obtained from the Tissue Core Facility at the Moffitt Cancer Center. DNA was extracted using the DNeasy tissue kit (Qiagen, Valencia, CA) according to the manufacturer's recommendations. Genomic DNA samples from cultured cell lines were extracted from cell cultures using a PureLink Genomic DNA Isolation Kit (Invitrogen-Life Technologies) according to the manufacturer's recommendations. Genomic DNA samples were quantified using a NanoDrop (Thermo Scientific). All genomic DNA samples, from patient samples and cell lines, were stored at −80°C.
The p73 DNP was determined using a commercially available TaqMan Real-Time PCR allelic discrimination assay (Life Technologies; Assay ID number C_16180356_10) and TaqMan Gene Expression Assay Master Mix (Applied Biosystems-Life Technologies; part number 4369016) according to the manufacturer's protocol. Genotyping assays (20 μL reaction volume) included 20 ng of genomic DNA and were performed using a 7900HT Fast Real-Time PCR System (Applied Biosystems-Life Technologies).

Carastro L.M., Lin H.Y., Park H.Y., Kim D., Radlein S., Hampton K.K., Hakam A., Zachariah B., Pow-Sang J, & Park J.Y. (2014). Role of p73 Dinucleotide Polymorphism in Prostate Cancer and p73 Protein Isoform Balance. Prostate Cancer, 2014, 129582.

+ Open protocol

+ Expand

CYP1A2 Polymorphism Analysis via qPCR

Check if the same lab product or an alternative is used in the 5 most similar protocols

DNA isolations were carried out from the peripheral blood samples and completed by a commercially available PureLink Genomic DNA isolation kit (Invitrogen, Van Allen Way Carlsbad, CA, USA), following the manufacturer protocols. Analysis of CYP1A2 rs2069514 rs762551 polymorphisms was performed by Thermo Fisher Quanti Studio 5 Real-Time PCR (Thermo scıentefic, Waltham, Massachusetts, USA) system, using the TaqMan Genotyping Assays (Applied Biosystems Foster City, CA, USA) genotyping kit following the directions of the manufacturer protocols, as previously described [21 ].

Bozkurt I., Gözler T., Yüksel I., Ulucan K, & Tarhan K. (2023). Prognostic Value of CYP1A2 (rs2069514 and rs762551) Polymorphisms in COVID-19 Patients. Balkan Journal of Medical Genetics : BJMG, 26(1), 35-42.

+ Open protocol

+ Expand

Mosquito DNA Isolation Using PureLink Kit

Check if the same lab product or an alternative is used in the 5 most similar protocols

DNA isolation was performed using PureLink® Genomic DNA Isolation Kit (Invitrogen, Carlsbad, USA) in combination with occasional vortexing using glass beads to ease mosquitoes lysis. Dead and surviving mosquitoes from different collection sites from bioassays were extracted individually.

Hamid P.H., Prastowo J., Widyasari A., Taubert A, & Hermosilla C. (2017). Knockdown resistance (kdr) of the voltage-gated sodium channel gene of Aedes aegypti population in Denpasar, Bali, Indonesia. Parasites & Vectors, 10, 283.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!