Total RNA from resting or CpG ODN-treated DCs were isolated with the Nucleospin RNA Plus extraction kit (Macherey-Nagel, Hoerdt, France), and cDNA were synthesized from 1 mg of total RNA with random hexamer primers and Superscript III (Invitrogen, Cergy Pontoise, France) according to standard procedures. cDNAs were used as templates for PCR amplification with the SYBR Green PCR Master Mix (Molecular Probes, Leiden, the Netherlands) and the ABI PRISM 7700 Sequence Detector (Applied Biosystems, Foster City, CA). Primers, which are listed in S2 Table , were designed by the Primer Express Program (Applied Biosystems) and used for amplification in triplicate assays. PCR amplification of Gapdh was performed to control for sample loading and to allow normalization between samples. ΔCt values were obtained by deducting the raw cycle threshold (Ct values) obtained for Gapdh mRNA, the internal standard, from the Ct values obtained for investigated genes. For graphical representation, data are expressed as relative expression of mRNA levels.
Nucleospin rna plus extraction kit
Manufactured by Macherey-Nagel
Sourced in Germany, France
The NucleoSpin RNA Plus extraction kit is a product by Macherey-Nagel designed for the isolation of high-quality RNA from a variety of sample types. The kit utilizes silica-membrane technology to effectively capture and purify RNA molecules.
Automatically generated - may contain errors
Lab products found in correlation
High capacity cdna reverse transcription kit, by Thermo Fisher Scientific (5 mentions)
Superscript 3 first strand synthesis system, by Thermo Fisher Scientific (2 mentions)
Lightcycler 480, by Roche (2 mentions)
Revertaid first strand cdna synthesis kit, by Thermo Fisher Scientific (2 mentions)
Dnase 1, by Thermo Fisher Scientific (2 mentions)
Sybr green pcr master mix, by Thermo Fisher Scientific (1 mentions)
Primer express program, by Thermo Fisher Scientific (1 mentions)
Abi prism 7700 sequence detector, by Thermo Fisher Scientific (1 mentions)
Superscript 3, by Thermo Fisher Scientific (1 mentions)
Omni tissue homogeniser, by Omni International (1 mentions)
Bioanalyzer rna 6000 nano kit, by Agilent Technologies (1 mentions)
Qubit rna hs assay kit, by Thermo Fisher Scientific (1 mentions)
Qbase software, by CellCarta (1 mentions)
Trizol reagent, by Thermo Fisher Scientific (1 mentions)
Sybr green master mix, by Roche (1 mentions)
Nanodrop device, by Thermo Fisher Scientific (1 mentions)
Tissuelyser, by Qiagen (1 mentions)
2100 bioanalyzer, by Agilent Technologies (1 mentions)
Nucleospin rna plus kit, by Macherey-Nagel (1 mentions)
Pump system, by Ibidi (1 mentions)
15 protocols using nucleospin rna plus extraction kit
1
Quantitative RT-PCR Analysis of DCs
2
Quantitative Analysis of Bone Marrow Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Whole, marrow flushed femora were collected and homogenised using the Omni tissue homogeniser (Omni, Kennesaw, GA, USA) in Trizol reagent (Ambion, Austin, TX, USA). RNA was extracted using the NucleoSpin RNA Plus extraction kit (Macherey-Nagel, Düren, Germany). RNA quality was confirmed with the Qubit RNA HS assay kit (Invitrogen, Carlsbad, CA, USA) and the Bioanalyzer RNA 6000 Nano kit (Agilent, Santa Clara, CA, USA). For qPCR analysis, RNA was primed with random primers and OligoDT and cDNA was prepared using the SuperScript III First-Strand Synthesis System (ThermoFisher Scientific). PCR was carried out on the LightCycler 480 (Roche, Basel, Switzerland) using the SYBR Green master mix (Roche). Gene expression was quantified relative to three housekeeping genes using the LightCycler 480 software (Roche) and the qBase+ software (Biogazelle, Ghent, Belgium).
3
RNA Extraction from Neonatal Brain Tissue
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA were extracted from brain hemispheres, ipsilateral to ligature at 3, 6, 12, or 24 h after HI procedure at P5 or P10 in sex-matched groups and from the right brain hemispheres of age- and time-matched naive animals (details in Supplementary Material ). RNA samples at P2 and P15 required for the developmental study were collected in 8 separate pools each of 6 sex-matched animals at both stages (③ in Figure 1 ). Brain tissues were defrosted in 350 μl lysis buffer from NucleoSpin RNA Plus extraction kit (Macherey-Nagel, Hoerdt, France) and homogeneized using ceramic beads (1.4 mm Ozyme, Montigny le Bretonneaux) in a tissue lyser® (Qiagen, Courtaboeuf, France) for 20 s at 50 hz. Total RNAs extraction was performed using Nucleospin RNA plus kit® according to manufacturer instructions (Macherey-Nagel) in 350 μL and frozen at −80°C. The integrity and quantity of isolated mRNAs were assessed using the 2100 Bio-analyzer (Agilent Technologies, Santa Clara, CA, United States) and the Nanodrop device (Thermo Scientific, Wilmington, United States). See details in Supplementary Material . Pooled samples for microarray study were made with 5 μg of total RNA extracted from 6 ipsilateral hemispheres of sex matched injured or control mice at both ages and all time points.
4
Transcriptomic Profiles of hiPS-Derived Endothelial Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
After sorting, 2.5–3.5 × 10^5 hiPS-ECs were plated on an Ibidi μ-Slide I Luer (80176, Ibidi). 4.0–6.0 × 10^5 hiPS-ECs were plated in one well in 6-well plate (static control). After 24 h, the cells on Ibidi slide were subjected to laminar shear stress of 15 dyn/cm2 by using the Ibidi Pump System (10902, Ibidi). After 24 h of exposure to flow, the cells were processed either for bulk RNA-sequencing or single-cell RNA-sequencing. The static control cells were processed at the same time. For bulk RNA-sequencing, the cells were collected into the RA1 lysis buffer and extracted using the Nucleospin RNA Plus Extraction kit (740984, Macherey-Nagel). Each experiment (whether for scRNASeq or bulk RNASeq) consists of one differentiation round from each hiPS cell line.
5
RNA Extraction, cDNA Conversion, and qRT-PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was isolated with the Nucleospin RNA Plus extraction kit (Macherey-Nagel), quantified with a NanoDrop ND-1000 spectophotometer (Thermo Scientific, Wathman, USA), and converted into cDNA with the high capacity cDNA reverse transcription kit (Life Technologies GmbH, Darmstadt, Germany). Semi-quantitative qRT-PCR was performed with TaqManTM gene expression master mix in a StepOnePlus machine (Applied Biosystems, Carlsbad, USA) using gene-specific TaqManTM assays (Table S2 ). Expression of glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was used as reference.
6
Extraction and Reverse Transcription of Mammalian Cell RNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To extract total RNA from mammalian cell cultures, the Nucleospin RNA Plus extraction kit (Macherey-Nagel) was used following the manufacturer's instructions. The concentration of the resulting RNA was determined spectro-photometrically. For preparation of 20 μl cDNA, 1 μg of isolated RNA was diluted in RNAse-free ddH2O to achieve a final volume of 11 μl and incubated at 65°C for 5 minutes with 1 μl of random hexamer primer. Subsequently, 4 μl of 5x Revert Aid reaction buffer, 1 μl of RiboLock RNase inhibitor, 2 μl of 10 mM dNTPs, and 1 μl of RevertAid reverse transcriptase (from the RevertAid First Strand cDNA Synthesis Kit, Thermo Fisher Scientific) were added. The reaction mix was incubated at 25°C for 5 minutes, followed by a 60-minute incubation step at 45°C for reverse transcription. Finally, the reverse transcription was terminated by incubating the samples at 70°C for 5 minutes. The cDNA was stored at -20°C until further use.
7
SRK Gene Expression Analysis in Floral Buds
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA extraction was performed onto stages 11–14 floral buds with the nucleospin RNA Plus Extraction kit (Macherey Nagel, GmbH and Co. DE). For each line, floral buds were harvested onto three different individuals. cDNA synthesis was performed using RevertAid Reverse Transcriptase (Thermo Fisher Scientific, Massachusetts, USA). 1 µg of extracted RNA was mixed with 0.2 µg of Random hexamer primer, psq H2O 12.5 µL. After incubation at 65°C, 4 µL of 5X reaction buffer; 0,5 µL of Riboblock RNase inhibitor (Thermo Fisher Scientific, Massachusetts, USA), 10 mM of each dNTP and 200 U of RevertAid Reverse Transcriptase were added and incubated firstly at 25°C and then 10 min at 42°C. cDNA quantification was performed in triplicate using LightCycler 480 Instrument II (Roche molecular systems, Inc, Pleasanton, USA). cDNA amplification of SRK fragments was performed with forward primer located on the S-domain (For: AGGAATGTGAGGAGAGGTGC ) and the reverse primer located on the second exon (Rev: TCCTACTGTTGTTGTTGCCC ). According to Liu et al. (2007) (link), Ubiquitin was used as housekeeping gene (For: CTGAGCCGGACAGTCCTCTTAACTG ; Rev: CGGCGAGGCGTGTATACATTTGTG ).
8
TMPRSS2-Expressing Huh-7 Cells Infected with HCoV-229E
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Huh-7-TMPRSS2 cells seeded in 24-well plates were inoculated with HCoV-229E at an MOI of 4 on ice in the presence of 4.1 or 8.2 μM Pba under the light of the BSC. One hour after inoculation, cells were washed 3 times with cold PBS and lysed using LBP lysis buffer for RNA extraction by following the manufacturer’s instructions (NucleoSpin RNA plus extraction kit; Macherey-Nagel). Reverse transcription was then performed on 10 μl of RNA using a high-capacity cDNA reverse transcription kit (Applied Biosystems). Three microliters of cDNA was used for real-time reverse-transcription PCR (qRT-PCR) assay using specific primers and probe targeting the N gene (forward primer, 5′-TTCCGACGTGCTCGAACTTT -3′; reverse primer, 5′-CCAACACGGTTGTGACAGTGA -3′; and probe, 5′-6FAM-TCCTGAGGTCAATGCA -3′) and subjected to qPCR amplification with TaqMan master mix.
9
Medicago truncatula Transcriptome During Seed Development
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For the loss-of-function study, seeds of Medicago truncatula abi3-1 (NF6003), abi3-2 (NF3185), and corresponding sibling wild-type lines R108 were freshly harvested from three different developmental stages (16, 24, and 40 days after pollination (DAP)) and directly frozen in liquid nitrogen. Total RNA was purified using the NucleoSpin® RNA Plus extraction kit (Macherey-Nagel, Düren, Germany), following the manufacturer’s instructions. Quantity and quality of RNA were measured using a NanoDrop ND-1000 (NanoDrop Technologies, Thermo Fisher Scientific, Waltham, MA, USA), and integrity was checked using a Bioanalyzer Agilent 2100. RNA amplification, labeling, and hybridization of Nimblegen Medtr v1.0 12 × 135K arrays were performed according to Terrasson et al., 2013 [60 (link)]. Three biological replicates were analyzed per comparison using the dye-swap method, and statistical analysis on the gene expression data was performed according to Terrasson et al., 2013 [60 (link)]. Raw and analyzed transcriptome data are openly available on the Gene Expression Omnibus platform as GSE181013 and GSE180917.
10
Temporal Dynamics of CM Differentiation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA samples were collected from CM differentiation experiments on days 1, 3, 5, 7, 9, 11, 13, and 20. RNA was extracted using Nucleospin RNA Plus Extraction kit (740984, Macherey-Nagel). cDNA synthesis was performed using High Capacity cDNA Reverse Transcription Kit (4368814, Thermo). qPCR analysis was done using SYBR Green (04913914001, Roche) and Bio-Rad CFX96 Real-Time PCR Detection System. All results were first normalized to housekeeping gene RPL37A and then to the expression levels during day 1.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!