Log In Sign up
The largest database of trusted experimental protocols

Ambion silencer select predesigned sirnas

Manufactured by Thermo Fisher Scientific
Visit Supplier

Ambion® Silencer® Select Predesigned siRNAs are synthetic, double-stranded RNA molecules designed to induce RNA interference (RNAi) and silence the expression of specific target genes. These siRNAs are pre-designed and optimized to provide efficient gene silencing.

Automatically generated - may contain errors

Lab products found in correlation

Close spelling variants of this product

Silencer select predesigned siRNAs Ambion Silencer Select siRNAs Silencer Select Predesigned Ambion™ Silencer™ siRNA Ambion Silencer Select Silencer Select siRNAs Predesigned siRNAs Silencer siRNA Ambion siRNAs Silencer Select

2 protocols using ambion silencer select predesigned sirnas

1

Epsin 1 and 2 Knockdown in HT-29 Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
HT-29 cells were transfected by RNAiMAX according to the manufacturer’s instructions with siRNA duplexes of scrambled or human epsin 1 (UGCUCUUCUCGGCUCAAACUAAGGG) and epsin 2 (AAAUCCAACAGCGUAGUCUGCUGUG), designed using Ambion® Silencer® Select Predesigned siRNAs (Invitrogen). At 48 h post-transfection, cells were processed for Western blotting.
Chang B., Tessneer K.L., McManus J., Liu X., Hahn S., Pasula S., Wu H., Song H., Chen Y., Cai X., Dong Y., Brophy M.L., Rahman R., Ma J.X., Xia L, & Chen H. (2015). Epsin is required for Dishevelled stability and Wnt signaling activation in colon cancer development. Nature communications, 6, 6380.
+ Open protocol
+ Expand
2

Epsin 1 and 2 Knockdown in HT-29 Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
HT-29 cells were transfected by RNAiMAX according to the manufacturer’s instructions with siRNA duplexes of scrambled or human epsin 1 (UGCUCUUCUCGGCUCAAACUAAGGG) and epsin 2 (AAAUCCAACAGCGUAGUCUGCUGUG), designed using Ambion® Silencer® Select Predesigned siRNAs (Invitrogen). At 48 h post-transfection, cells were processed for Western blotting.
Chang B., Tessneer K.L., McManus J., Liu X., Hahn S., Pasula S., Wu H., Song H., Chen Y., Cai X., Dong Y., Brophy M.L., Rahman R., Ma J.X., Xia L, & Chen H. (2015). Epsin is required for Dishevelled stability and Wnt signaling activation in colon cancer development. Nature communications, 6, 6380.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!