Using TRIzol reagent (Invitrogen), total RNA was extracted from kidney tissues or HK-2 cells; and cDNA was prepared using the reverse transcription kit (Promega, Madison, Wisconsin, USA) according to the instructions. The real-time PCR was performed using SYBR Premix Ex Taq II on Agilent Mx3000P qPCR System (Agilent, CA). The sequence of primers used in the experiment is shown in Table 1. The relative expression of the target gene was calculated by 2 -ΔΔCT method.
Sybr premix ex taq 2
Manufactured by Agilent Technologies
Sourced in United States
SYBR Premix Ex Taq II is a ready-to-use PCR master mix formulation that contains SYBR Green I dye, Taq DNA polymerase, dNTPs, and optimized buffer components. It is designed for efficient and sensitive real-time PCR amplification.
Automatically generated - may contain errors
Lab products found in correlation
Revertaid first strand cdna synthesis kit, by Thermo Fisher Scientific (4 mentions)
Agilent mx3000p qpcr system, by Agilent Technologies (2 mentions)
Trizol reagent, by Thermo Fisher Scientific (2 mentions)
Reverse transcription kit, by Promega (2 mentions)
Mx3005p qpcr system, by Agilent Technologies (1 mentions)
Rnasimple total rna kit, by Tiangen Biotech (1 mentions)
Mx3000p machine, by Agilent Technologies (1 mentions)
Real time pcr system, by Agilent Technologies (1 mentions)
Mx3000p qpcr system, by Agilent Technologies (1 mentions)
Iq5 system, by Bio-Rad (1 mentions)
Mirneasy mini kit, by Qiagen (1 mentions)
7 protocols using sybr premix ex taq 2
1
Kidney RNA Extraction and qRT-PCR Analysis
2
Quantifying gp91 phox mRNA in PVN
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Real-time PCR was done for gp91 phox mRNA in PVN as previously described (Yu et al. 2021a) . Total RNA was extracted from the PVN using TRIzol following the manufacturer's guidance. cDNA was synthesized using PrimeScrpt RT Master Mix. Real-time PCR was then performed using the SYBR Premix Ex Taq II in a Mx3005P qPCR system (Agilent Technologies, Santa Clara, CA, USA). The primer sequence used in this study is: forward primer 5′-CTGCCAGTGTGTCGGAATCT-3′; and reverse primer 5′-TGTGAATGGCCGTGTGAAGT-3′.
3
Quantitative RNA Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA from stably infected PANC-1cells was extracted using the RNA simple Total RNA Kit (DP419, TIANGEN Biotech, Beijing). The first-strand of the cDNA was synthesized from total RNA using Revert Aid™ First Strand cDNA Synthesis Kit (Thermo Fisher Scientific). Real-time PCR was performed with the following specific primers of KLK7: sense, 5′-ACCTCATGCTCGTGAAGCTC-3′; anti-sense, 5′-CCGGAGACAGTACAGGTGGT-3′. For GAPDH analysis (inner control), the following primers were used: sense, 5′-CAAGGTCATCCATGACAACTTTG-3′; anti-sense, 5′-GTCCACCACCCTGTTGCTGTAG-3′. Real-time PCR was performed on an Agilent Statagene Mx3000P machine using the SYBR Green II Dye detection system (SYBR® Premix Ex Taq™ II, RR820A). Relative levels of gene expression were normalized against the level of GAPDH.
4
Quantification of Osteogenic Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from osteoblasts and right tibia after treatments, using TRIZOL.
reagent. Reverse transcription was conducted with 0.8 μg of total RNA using the PrimeScript one-step RT-PCR kit. Real-time PCR was carried out in a Real-Time PCR System (Stratagene/Agilent Technologies, Wilmington, DE, USA) using SYBR Premix Ex TaqII. The cycling conditions were as follows: 95 °C for 2 min and 40 cycles of 95 °C for 5 sec, 60 °C for 30 sec [11 (link)]. For each rat, the gene expression was normalized with that of the housekeeping gene Gapdh and expressed as 2-ΔΔCt. The following primers were used [13 (link), 14 (link)]: Gapdh region sense: AGACAGCCGCATCTTCTTGT and region antisense: TGATGGCAACAATGTCCACT; Osx region sense: GGCTTTTCTGTGGCAAGAGGTT and region antisense: CGCTGATGTTTGCTCAAGTGGTC; Alpl region sense: CCAGAAAGACACGTTGACTGTGG, and region antisense: TCTTGTCCGTGTCGCTCACCAT; Ocn region sense: AGCTCAACCCCAATTGTGAC and region antisense: TCCTGGAGAGTAGCCAAAGC; Opn region sense: GCTAAGCCTCAGCATCCTTG and region antisense: AAGCAAACCACTGCCAGTCT; Rage region sense: ACAGAAACCGGTGATGAAGG, and region antisense: ATTCAGCTCTGCACGTTCCCT.
reagent. Reverse transcription was conducted with 0.8 μg of total RNA using the PrimeScript one-step RT-PCR kit. Real-time PCR was carried out in a Real-Time PCR System (Stratagene/Agilent Technologies, Wilmington, DE, USA) using SYBR Premix Ex TaqII. The cycling conditions were as follows: 95 °C for 2 min and 40 cycles of 95 °C for 5 sec, 60 °C for 30 sec [11 (link)]. For each rat, the gene expression was normalized with that of the housekeeping gene Gapdh and expressed as 2-ΔΔCt. The following primers were used [13 (link), 14 (link)]: Gapdh region sense: AGACAGCCGCATCTTCTTGT and region antisense: TGATGGCAACAATGTCCACT; Osx region sense: GGCTTTTCTGTGGCAAGAGGTT and region antisense: CGCTGATGTTTGCTCAAGTGGTC; Alpl region sense: CCAGAAAGACACGTTGACTGTGG, and region antisense: TCTTGTCCGTGTCGCTCACCAT; Ocn region sense: AGCTCAACCCCAATTGTGAC and region antisense: TCCTGGAGAGTAGCCAAAGC; Opn region sense: GCTAAGCCTCAGCATCCTTG and region antisense: AAGCAAACCACTGCCAGTCT; Rage region sense: ACAGAAACCGGTGATGAAGG, and region antisense: ATTCAGCTCTGCACGTTCCCT.
5
Quantifying Gene Expression in Kidney Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Using TRIzol reagent (Invitrogen), total RNA was extracted from kidney tissues or HK-2 cells, and cDNA was prepared using a reverse transcription kit (Promega, Madison, WI, USA) according to the instructions. Real-time PCR was performed using SYBR Premix Ex Taq II on an Agilent Mx3000P qPCR System (Agilent, CA), and GAPDH served as an internal control [27 (link), 28 (link)]. The primers used were as follows: NQO1 (human), F: ATGTATGACAAAGGACCCTTCC and R: TCCCTTGCAGAGAGTACATGG; Sirt1 (human), F: CAGTGTCATGGTTCCTTTGC and R: CACCGAGGAACTACCTGAT; GAPDH (human), F: CTGACTTCAACAGCGACACC and R: TGCTGTAGCCAAATTCGTTGT; NQO1 (mouse), F: AGGATGGGAGGTACTCGAATC and R: TGCTAGAGATGACTCGGAAGG; Sirt1 (mouse), F: TCAGAGTTGCCACCAACAC and R: TACTGGAACCAACAGCCTTA; and GAPDH (mouse), F: CGGAGTCAACGGATTTGGTCGTAT and R: AGCCTTCTCCATGGTGGTGAAGAC. The relative expression of each target gene was calculated by the 2−ΔΔCT method.
6
Quantitative RT-PCR for Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
After kidneys or HK-2 cells were lysed, total RNA was extracted using the TRIzol reagent and RT-qPCR kits. The sequences of the primers (Table 1 ) were designed and synthesized by Sangon Biotech Co, Ltd. (Shanghai, China). RT-qPCR was conducted in a 96-well plate using SYBR Premix Ex Taq™ II, and the reactions were performed on an Agilent Mx3000P QPCR System (Agilent, CA, USA). The results were calculated using the 2−ΔΔCT method, and all experiments were repeated at least thrice.
7
Quantitative Expression Analysis of RNA and miRNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from cells using the QIAGEN miRNeasy Mini kit (QIAGEN, CA, USA) according to the manufacturer's instructions. Cell-derived total RNA was reverse transcribed using a miRNA-specific stem-loop real-time reaction with transcription primers. The concentration of total RNA was quantified using an UV–Vis spectrophotometer (Nabi, MicroDigital Co., Ltd., Korea) via the A260/280 ratio; only pure total RNA samples within a ratio were selected. cDNA was synthesized using the RevertAid™ First Strand cDNA Synthesis Kit (Thermofisher, NZ, USA). Quantitative PCR was performed using the iQ5 system (Bio-Rad, ON, USA) with SYBR® Premix Ex Taq™ II (Agilent Technologies Inc. CA, USA) for quantification. Triplicates were tested for each sample. Gene and miRNA expression levels were normalized to GAPDH and U6 snRNA expression levels, respectively. Primer sequences are listed in Table II .
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!