Log In Sign up
The largest database of trusted experimental protocols

Taqman qpcr primers

Manufactured by Thermo Fisher Scientific
Visit Supplier
Sourced in United States

TaqMan qPCR primers are oligonucleotide sequences designed for use in quantitative real-time PCR (qPCR) experiments. They are specifically engineered to detect and amplify target DNA sequences. The primers work in conjunction with a TaqMan probe to provide accurate and sensitive quantification of gene expression levels.

Automatically generated - may contain errors

Lab products found in correlation

Data assist v2, by Thermo Fisher Scientific (2 mentions) Taqman universal pcr master mix, by Thermo Fisher Scientific (2 mentions) 7500 instrument, by Thermo Fisher Scientific (2 mentions) Ab7300 real time thermal cycler, by Thermo Fisher Scientific (2 mentions) Trizol reagent, by Thermo Fisher Scientific (1 mentions) Transcriptor first strand cdna synthesis kit, by Roche (1 mentions) Sds 2, by Thermo Fisher Scientific (1 mentions) Nanodrop 2000, by Thermo Fisher Scientific (1 mentions) Rm2235, by Leica (1 mentions) Ffpe rna extraction kit, by Qiagen (1 mentions)

Spelling variants of this product

TaqMan primers (539 citations) TaqMan qPCR (43 citations) QPCR primers (16 citations)

6 protocols using taqman qpcr primers

1

Measuring Gene Expression Profiles

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was isolated using the TRIZOL reagent according to the manufacturer’s instructions (Invitrogen, Waltham, MA, USA). A total of 1 μg of the total RNA was reverse-transcribed using a transcriptor first-strand cDNA synthesis kit (Roche Applied Science, Penzberg, Germany), and the cDNA samples were stored at –20 °C for use as a template in real-time polymerase chain reaction (PCR) analysis. The gene expression profiles were analyzed in an ABI PRISM 7900HF Sequence Detection System, using a predesigned and labeled primer/probe set (Assays-on-Demand™ Gene Expression Assay, Applied Biosystems, Foster City, CA, USA). The Taqman qPCR primers (Applied Biosystems, Foster City, CA, USA) used were as follows: human HMGCR (Hs00168352_m1), human LDL receptor (LDLR; Hs01092524_m1) and human GAPDH (NM_002046.3). All the reactions were performed with 100 ng of cDNA in a total volume of 50 μL of TaqMan® Universal PCR Master Mix (Applied Biosystems, Foster City, CA, USA), and the relative expression levels for each gene were calculated using the 2−ddCt method, with SDS2.3 and Data Assist V2.1 software (Applied Biosystems, Foster City, CA, USA), and GAPDH was used as the normalizing gene.
Revilla G., Ruiz-Auladell L., Vallverdú N.F., Santamaría P., Moral A., Pérez J.I., Li C., Fuste V., Lerma E., Corcoy R., Pitoia F., Escolà-Gil J.C, & Mato E. (2023). Low-Density Lipoprotein Receptor Is a Key Driver of Aggressiveness in Thyroid Tumor Cells. International Journal of Molecular Sciences, 24(13), 11153.
+ Open protocol
+ Expand
2

Neurotrophin Expression in Alzheimer's Disease

Cited 4 times
Check if the same lab product or an alternative is used in the 5 most similar protocols
qPCR was performed on frozen micropunches from the hippocampal CA1 region NCI (n = 12), MCI (n = 13), and mild/moderate AD (n = 14) RROS cases. Taqman qPCR primers (Applied Biosystems) were utilized for the following genes: Bdnf, Ngfb, Ntf3, TrkB, TrkC, and the housekeeping genes glyceraldehyde-3-phosphate dehydrogenase (Gapdh) as described previously (Alldred et al., 2015a (link), 2015b (link); Ginsberg et al., 2010 (link), 2011 (link)). Standard curves and cycle threshold (Ct) were measured using standards obtained from total human brain RNA. Samples were run in triplicate for the qPCR assessments. Negative controls consisted of the reaction mixture without input RNA.
Ginsberg S.D., Malek-Ahmadi M.H., Alldred M.J., Che S., Elarova I., Chen Y., Jeanneteau F., Kranz T.M., Chao M.V., Counts S.E, & Mufson E.J. (2017). Selective decline of neurotrophin and neurotrophin receptor genes within CA1 pyramidal neurons and hippocampus proper: correlation with cognitive performance and neuropathology in mild cognitive impairment and Alzheimer’s disease. Hippocampus, 29(5), 422-439.
+ Open protocol
+ Expand
3

Quantitative Gene Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
The gene expression profiles were analyzed in an ABI PRISM 7900HF Sequence Detection System, using a predesigned and labeled primer/probe set (Assays-on-Demand™ Gene Expression Assay, Applied Biosystems, Foster City, CA, USA). The Taqman qPCR primers (Applied Biosystems) used were as follows: CYP27A1 (Hs01017992_m1), CYP7B1 (Hs01046431_m1), HMGR (Hs00168352_m1), LDL receptor (LDLR; Hs01092524_m1), NR1H3 (Hs00172885_m1), SCARB1 (Hs00969827_m1), DHCR24 (Hs00207388_m1) and ABCA1 (Hs01059137_m1). All the reactions were performed with 100 ng of cDNA in a total volume of 50 μl of TaqMan® Universal PCR Master Mix (Applied Biosystems), and the relative expression levels for each gene were calculated using the 2- ddCt method, with SDS2.3 and Data Assist V2.1 software (Applied Biosystems). The samples were analyzed in duplicate, and RNA from BTT was used as a group calibrator; negative controls were also included in all the reactions.
Revilla G., Pons M.D., Baila-Rueda L., García-León A., Santos D., Cenarro A., Magalhaes M., Blanco R.M., Moral A., Ignacio Pérez J., Sabé G., González C., Fuste V., Lerma E., Faria M.D., de Leiva A., Corcoy R., Carles Escolà-Gil J, & Mato E. (2019). Cholesterol and 27-hydroxycholesterol promote thyroid carcinoma aggressiveness. Scientific Reports, 9, 10260.
+ Open protocol
+ Expand
4

Quantification of EcoHIV/NDK Viral DNA

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
The procedures for harvesting spleen, preparing cellular DNA, and detecting EcoHIV/NDK gag DNA by real-time quantitative PCR (qPCR) were performed as previously described (Hadas et al., 2007 (link); Kelschenbach et al., 2012 (link)). Splenic gag DNA was measured by isolating DNA from 5 × 106 cells and comparing copy number to the internal GAPDH reference. Custom Taqman QPCR primers were purchased from Applied Biosystems (ABI, Foster City, California, USA) and amplification was conducted in an Applied Biosystems 7500 instrument. EcoHIV/NDK DNA from the gag gene region was detected with forward primer 5′–TGGGACCACAGGCTACAC TAGA–3′, reverse primer 5′–CAGCCAAAACTCTTGCTTTATGG–3′ and probe 5′–TGATGACAGCATGCCAGGGAGTGG–3′. DNA content was standardized by amplification of murine β globin (forward primer, 5′–GGTTTCCTTCCCCTGGCTAT–3′; reverse primer, 5′–CGCTTCCCC TTTCCTTCTG–3′; probe, 5′–CTGCTCAACCTTCC–3′). Samples for qPCR were run in duplicate in the AB7300 real time thermal cycler (Thermo Fisher Scientific). DNA qPCR reactions were normalized by amplification of glyceraldehyde 3-phosphate dehydrogenase (GAPDH) using a kit from Applied Biosystems (ABI, Foster City, CA). Data analysis was performed with the 7300 System software according to the manufacturer’s instructions.
Zhu X., Hollinger K.R., Huang Y., Borjabad A., Kim B.H., Arab T., Thomas A.G., Moniruzzaman M., Lovell L., Turchinovich A., Witwer K.W., Volsky D.J., Haughey N.J, & Slusher B.S. (2022). Neutral sphingomyelinase 2 inhibition attenuates extracellular vesicle release and improves neurobehavioral deficits in murine HIV. Neurobiology of disease, 169, 105734.
+ Open protocol
+ Expand
5

Quantification of EcoHIV/NDK Viral DNA

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
The procedures for harvesting spleen, preparing cellular DNA, and detecting EcoHIV/NDK gag DNA by real-time quantitative PCR (qPCR) were performed as previously described (Hadas et al., 2007 (link); Kelschenbach et al., 2012 (link)). Splenic gag DNA was measured by isolating DNA from 5 × 106 cells and comparing copy number to the internal GAPDH reference. Custom Taqman QPCR primers were purchased from Applied Biosystems (ABI, Foster City, California, USA) and amplification was conducted in an Applied Biosystems 7500 instrument. EcoHIV/NDK DNA from the gag gene region was detected with forward primer 5′–TGGGACCACAGGCTACAC TAGA–3′, reverse primer 5′–CAGCCAAAACTCTTGCTTTATGG–3′ and probe 5′–TGATGACAGCATGCCAGGGAGTGG–3′. DNA content was standardized by amplification of murine β globin (forward primer, 5′–GGTTTCCTTCCCCTGGCTAT–3′; reverse primer, 5′–CGCTTCCCC TTTCCTTCTG–3′; probe, 5′–CTGCTCAACCTTCC–3′). Samples for qPCR were run in duplicate in the AB7300 real time thermal cycler (Thermo Fisher Scientific). DNA qPCR reactions were normalized by amplification of glyceraldehyde 3-phosphate dehydrogenase (GAPDH) using a kit from Applied Biosystems (ABI, Foster City, CA). Data analysis was performed with the 7300 System software according to the manufacturer’s instructions.
Zhu X., Hollinger K.R., Huang Y., Borjabad A., Kim B.H., Arab T., Thomas A.G., Moniruzzaman M., Lovell L., Turchinovich A., Witwer K.W., Volsky D.J., Haughey N.J, & Slusher B.S. (2022). Neutral sphingomyelinase 2 inhibition attenuates extracellular vesicle release and improves neurobehavioral deficits in murine HIV. Neurobiology of disease, 169, 105734.
+ Open protocol
+ Expand
6

RNA Extraction and qPCR Analysis of PD-DBS Brains

Check if the same lab product or an alternative is used in the 5 most similar protocols
Four 20-µm sections from each control and PD-DBS brain, from the same anatomical region as described above, were cut on a microtome (Leica RM 2235). The samples were immediately collected in RNAase-free tubes containing xylene and processed for mRNA extraction using the Qiagen FFPE RNA extraction kit (Qiagen, 74404). The concentration of total RNA extracted was measured using a Nanodrop 2000 (ThermoScientific). Only samples with a ratio of absorbance at 260 and 280 nm (A260/280 ratio) of over 1.85 were used for PCR. Following RT-PCR, qPCR using Taqman qPCR primers (Applied Biosystems, Foster City, CA) was performed for the following human genes: MCM2 and Sox2 and the housekeeping gene 18S using Sox2, and MCM2 Taqman gene expression assay kits (Hs01053049_s1 and Hs01091564_m1). Samples were assayed on a real-time qPCR cycler (7900HT, Applied Biosystems) in 96-well optical plates covered with caps. The comparative CT method (ΔΔCT) was employed to determine relative gene level differences between control and DBS tissue, and gene expression was normalized against that for the housekeeping gene 18S.
Vedam-Mai V., Gardner B., Okun M.S., Siebzehnrubl F.A., Kam M., Aponso P., Steindler D.A., Yachnis A.T., Neal D., Oliver B.U., Rath S.J., Faull R.L., Reynolds B.A, & Curtis M.A. (2014). Increased Precursor Cell Proliferation after Deep Brain Stimulation for Parkinson's Disease: A Human Study. PLoS ONE, 9(3), e88770.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!