Mmlv revertase

Total RNA from S.altissima plant organs was isolated by the hot phenolic method [52 (link)] and used as a template for the total first-strand cDNA synthesis. For amplification of the 3′- and 5′- ends of the SaNPF6.3 transcript by the Step-Out RACE method, the first-strand cDNA was synthesized on the total RNA template, isolated from Suaeda roots, using MINT revertase (Evrogen, Moscow, Russia). Full-length cDNA of SaNPF6.3 gene was also amplified on the total RNA template, isolated from Suaeda roots. To obtain full-length cDNA of SaNPF6.3 and quantify the representation of the gene transcripts in S. altissima organs, first-strand cDNA synthesis was performed on total RNA templates using (dT)15 primer and MMLV revertase (Evrogen, Moscow, Russia).

The cells were lysed using a commercial reagent ExtractRNA (Evrogen, Moscow, Russia). The total RNA was isolated using chloroform, isopropanol, and 75% ethanol. Reverse transcription to obtain cDNA was carried out in a thermal cycler (Applied Biosystems, USA) using a commercial kit containing MMLV revertase (Evrogen, Moscow, Russia) according to the manufacturer’s procedures. The primers used for the reaction were as follows: oligo-dT to total mRNA and specific primer for CIITA gene mRNA (5′ GGTGTCTGTGTCGGGTTCTG 3′) (Evrogen, Moscow, Russia). PCR was performed using polymerase master mix Maxima hot start (Evrogen, Moscow, Russia), with direct and reverse primers (Evrogen, Moscow, Russia) to β-actin (positive control), the α-subunit of HLA-DR and CIITA isoforms that differ in the structure of exon 1 and the untranslated region upstream of it. PCR results were visualized by electrophoresis using an automated gel imaging instrument (BioRad, Hercules, CA, USA).

Samples of total RNA isolated from D. maritima cells were used to synthesize total cDNA in a reverse transcription reaction with MMLV-revertase (“Evrogen”, Moscow, Russia) and a 12-dTVN oligo-dT primer. The reaction was carried out according to the manufacturer’s protocol.